Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for improving bacillus glycerin metabolism to increase yield of poly gamma-glutamic acid

A technology for Bacillus and glycerol metabolism, applied in the fields of genetic engineering and microbiology, to achieve the effects of improving glycerol metabolism, increasing poly-γ-glutamic acid synthesis, and wide application value

Active Publication Date: 2019-06-21
HUBEI UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The relationship between the strength of the flavin adenine dinucleotide synthesis pathway and the metabolic rate of glycerol and the production of poly-γ-glutamic acid has not been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving bacillus glycerin metabolism to increase yield of poly gamma-glutamic acid
  • Method for improving bacillus glycerin metabolism to increase yield of poly gamma-glutamic acid
  • Method for improving bacillus glycerin metabolism to increase yield of poly gamma-glutamic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Construction of the enhanced synthetic overexpression plasmid of Bacillus licheniformis FAD

[0037] 1. According to the gene sequence of ribE, ribF and ribH gene in the Bacillus licheniformis WX-02 genome DNA sequence, design ribE, ribF and ribH gene primers ribE-F / R, ribF-F / R and ribH-F / R and using the genomic DNA of Bacillus licheniformis WX-02 as a template, PCR amplification was carried out with ribE, ribF and ribH gene primers respectively to obtain ribE (648bp), ribF (960bp) and ribH (464bp) gene fragments.

[0038] Among them, the sequences of ribE-F and ribE-R are:

[0039] ribE-F: TAAGAGAGGAATGTACACATGAAGACGATACATATTTC,

[0040] ribE-R: TCCGTCCTCTCTGCTCTTCTAGATTCCGGCCGGCTTC;

[0041] Wherein, the sequences of ribF-F and ribF-R are:

[0042] ribF-F: TAAGAGAGGAATGTACACATGAAGACGATACATATTTC

[0043] ribF-R: TCCGTCCTCTCTGCTCTTCTAGATTCCGGCCGGCTTC.

[0044] The sequences of ribH-F and ribH-R are:

[0045] ribH-F: TAAGAGAGGAATGTACACATGAATAAAATAGAAGGTC

[0046] ...

Embodiment 2

[0071] Construction of the Enhanced Expression Strain of Bacillus licheniformis FAD

[0072] The expression vectors pHY-ribE, pHY-ribF and pHY-ribH were respectively transferred into Bacillus licheniformis WX-02 (this bacterium was preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number was CCTCC NO: M208065), specifically :

[0073] First prepare the competent Bacillus licheniformis WX-02, activate the strain on the plate, then pick the bacteria into a PA bottle containing 5-10mL LB, culture overnight at 30-37°C, and then transfer with an inoculum of 3-5% Into the growth medium, 30~37℃, 180~200rpm culture to OD 600 Centrifuge at 0.80-0.90, 5500-7000rpm for 6-8min to collect the bacteria, resuspend the bacteria with washing medium, centrifuge at 5500-7000rpm for 6-8min, repeat three times, add 0.8-1mL of washing medium to resuspend the bacteria, and pack Transfer to sterilized 1.5mL EP tubes, aliquot 80-100uL for each tube, and store at...

Embodiment 3

[0079] Effects of enhanced flavin adenine dinucleotide (FAD) synthesis on glycerol metabolism and poly-γ-glutamic acid production

[0080] According to the above-mentioned FAD, the inventors strengthened the synthesis of Bacillus licheniformis WX-02 / pHY-ribE, WX-02 / pHY-ribF and WX-02 / pHY-ribH on glycerol metabolism and poly-γ-glutamine in different fermentation media. The study on the influence of acid synthesis provides 10 implementation cases, and Table 1 lists the formulations of the fermentation medium in experimental group 1-experimental group 10 respectively.

[0081] Table 1 experimental group 1-experimental group 10 adopts the formula table of fermentation medium

[0082]

[0083] Strains: WX-02, WX-02 / pHY-ribE, WX-02 / pHY-ribF and WX-02 / pHY-ribH.

[0084] Seed solution preparation: activate wild bacteria and their deletion strains on the plate, pick the bacteria and transfer them to a liquid LB Erlenmeyer flask with a liquid volume of 20%, and cultivate them at 37°...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving bacillus glycerin metabolism to increase yield of poly gamma-glutamic acid by enhancing synthesis of flavin adenine dinucleotide (FAD). Three FAD enhanced synthetic strains are respectively built by enhancing expression of three key genes ribE, ribF and ribH in bacillus in a FAD synthesis path. In different liquid fermentation conditions, overexpression of ribE, ribF and ribH enables glycerin metabolic capacity to be improved by at least 22.02%, 20.62% and 23.92% respectively when compared with that of a comparison strain, and poly gamma-glutamicacid yield of these recombinant strains are at least 1.20, 1.18 and 1.27 times of that of the comparison strain. It shows that enhancing of FAD synthesis can remarkably improve bacillus glycerin metabolism and increase synthesis of poly gamma-glutamic acid. The method can improve glycerin utilization to enhance synthesis of a target produce and has wide application value in the aspect of utilizingglycerin as a raw material for microbial fermentation to synthesize a bio-based compound, and a new strategy is provided for microorganisms to efficiently utilize glycerin to synthesize bio-based chemicals.

Description

technical field [0001] The invention relates to the technical fields of genetic engineering and microbiology, in particular to a method for improving the glycerol metabolism of bacillus by strengthening the synthesis of flavin adenine dinucleotide and increasing the yield of poly-γ-glutamic acid. Background technique [0002] Poly-γ-glutamic acid is a multifunctional polymer produced by microbial fermentation. It is an anionic compound formed by connecting D-glutamic acid or L-glutamic acid units through γ-amide bonds. It has good cationic properties. With the characteristics of chelation, water absorption and moisturizing, non-toxic and biodegradable, it can be used as a drug carrier, mineral nutrition enhancer, flocculant, humectant, and fertilizer accelerator in the fields of medicine, food, water treatment, cosmetics, and agriculture. At present, the main raw materials for industrial production of poly-γ-glutamic acid are high-cost glucose and glutamic acid, etc., result...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P13/02C12N15/75C12N1/21C12R1/10
Inventor 陈守文许勇占杨杨王欢石姣周梦林马昕李鑫
Owner HUBEI UNIV