Method for improving bacillus glycerin metabolism to increase yield of poly gamma-glutamic acid
A technology for Bacillus and glycerol metabolism, applied in the fields of genetic engineering and microbiology, to achieve the effects of improving glycerol metabolism, increasing poly-γ-glutamic acid synthesis, and wide application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Construction of the enhanced synthetic overexpression plasmid of Bacillus licheniformis FAD
[0037] 1. According to the gene sequence of ribE, ribF and ribH gene in the Bacillus licheniformis WX-02 genome DNA sequence, design ribE, ribF and ribH gene primers ribE-F / R, ribF-F / R and ribH-F / R and using the genomic DNA of Bacillus licheniformis WX-02 as a template, PCR amplification was carried out with ribE, ribF and ribH gene primers respectively to obtain ribE (648bp), ribF (960bp) and ribH (464bp) gene fragments.
[0038] Among them, the sequences of ribE-F and ribE-R are:
[0039] ribE-F: TAAGAGAGGAATGTACACATGAAGACGATACATATTTC,
[0040] ribE-R: TCCGTCCTCTCTGCTCTTCTAGATTCCGGCCGGCTTC;
[0041] Wherein, the sequences of ribF-F and ribF-R are:
[0042] ribF-F: TAAGAGAGGAATGTACACATGAAGACGATACATATTTC
[0043] ribF-R: TCCGTCCTCTCTGCTCTTCTAGATTCCGGCCGGCTTC.
[0044] The sequences of ribH-F and ribH-R are:
[0045] ribH-F: TAAGAGAGGAATGTACACATGAATAAAATAGAAGGTC
[0046] ...
Embodiment 2
[0071] Construction of the Enhanced Expression Strain of Bacillus licheniformis FAD
[0072] The expression vectors pHY-ribE, pHY-ribF and pHY-ribH were respectively transferred into Bacillus licheniformis WX-02 (this bacterium was preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number was CCTCC NO: M208065), specifically :
[0073] First prepare the competent Bacillus licheniformis WX-02, activate the strain on the plate, then pick the bacteria into a PA bottle containing 5-10mL LB, culture overnight at 30-37°C, and then transfer with an inoculum of 3-5% Into the growth medium, 30~37℃, 180~200rpm culture to OD 600 Centrifuge at 0.80-0.90, 5500-7000rpm for 6-8min to collect the bacteria, resuspend the bacteria with washing medium, centrifuge at 5500-7000rpm for 6-8min, repeat three times, add 0.8-1mL of washing medium to resuspend the bacteria, and pack Transfer to sterilized 1.5mL EP tubes, aliquot 80-100uL for each tube, and store at...
Embodiment 3
[0079] Effects of enhanced flavin adenine dinucleotide (FAD) synthesis on glycerol metabolism and poly-γ-glutamic acid production
[0080] According to the above-mentioned FAD, the inventors strengthened the synthesis of Bacillus licheniformis WX-02 / pHY-ribE, WX-02 / pHY-ribF and WX-02 / pHY-ribH on glycerol metabolism and poly-γ-glutamine in different fermentation media. The study on the influence of acid synthesis provides 10 implementation cases, and Table 1 lists the formulations of the fermentation medium in experimental group 1-experimental group 10 respectively.
[0081] Table 1 experimental group 1-experimental group 10 adopts the formula table of fermentation medium
[0082]
[0083] Strains: WX-02, WX-02 / pHY-ribE, WX-02 / pHY-ribF and WX-02 / pHY-ribH.
[0084] Seed solution preparation: activate wild bacteria and their deletion strains on the plate, pick the bacteria and transfer them to a liquid LB Erlenmeyer flask with a liquid volume of 20%, and cultivate them at 37°...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



