Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Radix scutellariae flavone phenylpropanoidand and flavonoid O-methyltransferase gene and vector construction and application thereof

A technology of baicalin flavonoid phenylpropanoid and baicalin phenylpropanoid, applied in the field of construction and application of baicalin baicalenone phenylpropanoid and flavonoid O-methyltransferase genes and their vectors

Inactive Publication Date: 2019-07-23
SHANGHAI CHENSHAN BOTANICAL GARDEN
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few reports about the cloning of related genes encoding wogonin and flavone methylation pathways with similar structures from the plant Scutellaria baicalensis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Radix scutellariae flavone phenylpropanoidand and flavonoid O-methyltransferase gene and vector construction and application thereof
  • Radix scutellariae flavone phenylpropanoidand and flavonoid O-methyltransferase gene and vector construction and application thereof
  • Radix scutellariae flavone phenylpropanoidand and flavonoid O-methyltransferase gene and vector construction and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] This example is the cloning of SbPFOMT1, SbPFOMT2 and SbPFOMT5 genes of Scutellaria baicalensis and the construction of corresponding plant overexpression vectors and yeast expression vectors.

[0058] (1) Design and synthesis of primers for SbPFOMT1, SbPFOMT2, and SbPFOMT5 genes

[0059] Firstly, the transcriptome of Scutellaria baicalensis was deeply sequenced, and then compared with the sequences of phenylpropanoid and flavonoid O-methyltransferases of related species reported in Genbank, and some encoded proteins were selected to be similar. Scutellaria baicalensis for sequences with a degree of >50% was obtained, and primer premier 5.0 was used to design the full-length primers of the primers. At the same time, the primers of SbPFOMT1, SbPFOMT2, and SbPFOMT5 also added Gateway recombination sites (Gateway is underlined).

[0060] SbPFOMT1-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGCAAGCGTTCAAACTCAGG (SEQ ID No. 7);

[0061] SbPFOMT1-R: GGGGACCACTTTGTACAAGAAAGCTGGG...

Embodiment 2

[0081] This example is to verify the protein functions of the Scutellaria baicalensis SbPFOMT1, SbPFOMT2 and SbPFOMT5 genes in the yeast system.

[0082] Protein expression of Scutellaria baicalensis SbPFOMT1, SbPFOMT2, SbPFOMT5 genes in yeast:

[0083] Transform the yeast expression vectors pYES-dest52-SbPFOMT1, pYES-dest52-SbPFOMT2, pYES-dest52-SbPFOMT5 into the Saccharomyces cerevisiae WAT11 strain by chemical transformation to obtain the yeast strain containing the target gene, and transform the empty plasmid containing pYES-dest52 at the same time As a negative control, grow at 28° C. for 24-48 h in SD solid medium containing glucose and lacking Uracil (Ura).

[0084] Then pick a single clone and grow in 10mL SD liquid medium containing glucose and lacking Ura at 28°C and 200rpm for 24h to OD 600 Reach 2-3. Collect the thalline, and wash off the glucose in the thalline with sterile water. The bacteria were resuspended in 20 mL of SD liquid medium containing galactose a...

Embodiment 3

[0089] This example is to verify the protein functions of the Scutellaria baicalensis SbPFOMT1, SbPFOMT2 and SbPFOMT5 genes in the exogenous plant Arabidopsis.

[0090] The plant expression vectors pK7WG2R-SbPFOMT1, pK7WG2R-SbPFOMT2 and pK7WG2R-SbPFOMT5 were transformed into the Agrobacterium tumefaciens strain GV3101pMP90 by electric shock transformation method, and the empty plasmid containing the CaMV 35S promoter was transformed into the strain as a negative control.

[0091] Wild-type Arabidopsis col-0 was used as transgenic material. Arabidopsis thaliana seeds were sown into the soil, stored in the dark at 4°C for two days, and then transferred to a culture room with a light time of 16 hours, a temperature of 23°C and a humidity of 50% for cultivation. Arabidopsis was transformed by inflorescence dipping. After harvesting the seeds, the T1 generation seeds were sown on MS medium containing kanamycin (Kan) resistance for selection, and then transferred to soil. The posit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a radix scutellariae flavone phenylpropanoidand and flavonoid O-methyltransferase gene. The radix scutellariae flavone phenylpropanoidand and flavonoid O-methyltransferase genecomprises at least one of SbPFOMT1, SbPFOMT2 and SbPFOMT5 genes, the gene sequence of the SbPFOMT1 is as shown in SEQID No.1, the gene sequence of the SbPFOMT2 is as shown in SEQID No.3, and the genesequence of the SbPFOMT5 is as shown in SEQID No.5; and a primer composition amplifying the gene, protein coded by the gene, a recombinant vector, a recombinant microorganism, a host cell, a transgenic cell line, transgenic plant tissue or a transgenic plant constructed by the gene, and an application of the recombinant vector, the recombinant microorganism, the host cell, the transgenic cell line, the transgenic plant tissue or the transgenic plant are provided. The methylation process of wogonin and similar flavonoid is analyzed, 3 flavone phenylpropanoidand and flavonoid O-methyltransferasegenes SbPFOMT1, SbPFOMT2 and SbPFOMT5 are obtained for the first time and cloned, besides, the function of enzymes coded by the gene is verified in an exogenous plant and a microorganism body, a theoretical basis is provided for methylation of wogonin and similar flavonoid in mass production, and a firm basis is also established for industrial production of other pertinent flavonoid compounds.

Description

technical field [0001] The invention relates to the field of genetic engineering of medicinal plants, in particular to the construction and application of the Scutellaria baicalensis flavone phenylpropanoid and flavonoid O-methyltransferase genes and their vectors. Background technique [0002] Scutellaria baicalensis is a perennial herbaceous plant of the genus Scutellaria baicalensis in the Labiatae family. It has been used as a traditional medicinal plant for two thousand years; it is mainly used to treat upper respiratory tract infections, lung-heat cough, damp-heat jaundice, pneumonia, and dysentery. Modern medical research shows that the main active ingredients in Scutellaria baicalensis are the flavonoids that exist in large quantities in the roots: baicalein, wogonin and their glycosylated products baicalin, wogonin. According to animal cell experiments, it is found that the above-mentioned substances can be used as antioxidants, free radical scavengers and have the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/11C12P17/06
CPCC12N9/1007C12P17/06
Inventor 赵清崔孟颖柳洁方誉民凯西·马丁
Owner SHANGHAI CHENSHAN BOTANICAL GARDEN
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com