Radix scutellariae flavone phenylpropanoidand and flavonoid O-methyltransferase gene and vector construction and application thereof
A technology of baicalin flavonoid phenylpropanoid and baicalin phenylpropanoid, applied in the field of construction and application of baicalin baicalenone phenylpropanoid and flavonoid O-methyltransferase genes and their vectors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] This example is the cloning of SbPFOMT1, SbPFOMT2 and SbPFOMT5 genes of Scutellaria baicalensis and the construction of corresponding plant overexpression vectors and yeast expression vectors.
[0058] (1) Design and synthesis of primers for SbPFOMT1, SbPFOMT2, and SbPFOMT5 genes
[0059] Firstly, the transcriptome of Scutellaria baicalensis was deeply sequenced, and then compared with the sequences of phenylpropanoid and flavonoid O-methyltransferases of related species reported in Genbank, and some encoded proteins were selected to be similar. Scutellaria baicalensis for sequences with a degree of >50% was obtained, and primer premier 5.0 was used to design the full-length primers of the primers. At the same time, the primers of SbPFOMT1, SbPFOMT2, and SbPFOMT5 also added Gateway recombination sites (Gateway is underlined).
[0060] SbPFOMT1-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGCAAGCGTTCAAACTCAGG (SEQ ID No. 7);
[0061] SbPFOMT1-R: GGGGACCACTTTGTACAAGAAAGCTGGG...
Embodiment 2
[0081] This example is to verify the protein functions of the Scutellaria baicalensis SbPFOMT1, SbPFOMT2 and SbPFOMT5 genes in the yeast system.
[0082] Protein expression of Scutellaria baicalensis SbPFOMT1, SbPFOMT2, SbPFOMT5 genes in yeast:
[0083] Transform the yeast expression vectors pYES-dest52-SbPFOMT1, pYES-dest52-SbPFOMT2, pYES-dest52-SbPFOMT5 into the Saccharomyces cerevisiae WAT11 strain by chemical transformation to obtain the yeast strain containing the target gene, and transform the empty plasmid containing pYES-dest52 at the same time As a negative control, grow at 28° C. for 24-48 h in SD solid medium containing glucose and lacking Uracil (Ura).
[0084] Then pick a single clone and grow in 10mL SD liquid medium containing glucose and lacking Ura at 28°C and 200rpm for 24h to OD 600 Reach 2-3. Collect the thalline, and wash off the glucose in the thalline with sterile water. The bacteria were resuspended in 20 mL of SD liquid medium containing galactose a...
Embodiment 3
[0089] This example is to verify the protein functions of the Scutellaria baicalensis SbPFOMT1, SbPFOMT2 and SbPFOMT5 genes in the exogenous plant Arabidopsis.
[0090] The plant expression vectors pK7WG2R-SbPFOMT1, pK7WG2R-SbPFOMT2 and pK7WG2R-SbPFOMT5 were transformed into the Agrobacterium tumefaciens strain GV3101pMP90 by electric shock transformation method, and the empty plasmid containing the CaMV 35S promoter was transformed into the strain as a negative control.
[0091] Wild-type Arabidopsis col-0 was used as transgenic material. Arabidopsis thaliana seeds were sown into the soil, stored in the dark at 4°C for two days, and then transferred to a culture room with a light time of 16 hours, a temperature of 23°C and a humidity of 50% for cultivation. Arabidopsis was transformed by inflorescence dipping. After harvesting the seeds, the T1 generation seeds were sown on MS medium containing kanamycin (Kan) resistance for selection, and then transferred to soil. The posit...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



