Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Glucose tolerance beta-glucosidase apbgl 1a and gene and application thereof

A technology of glucose tolerance and glucosidase, applied in glucose tolerance beta-glucosidase apbgl1a and its gene and application fields

Pending Publication Date: 2019-07-30
SOUTHWEST FORESTRY UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, most β-glucosidases are sensitive to glucose, the final product of cellulose hydrolysis, and their inhibition constant Ki values ​​are between 0.5 and 100 mM

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glucose tolerance beta-glucosidase apbgl 1a and gene and application thereof
  • Glucose tolerance beta-glucosidase apbgl 1a and gene and application thereof
  • Glucose tolerance beta-glucosidase apbgl 1a and gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0022] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only some, not all, embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.

[0023] 1. The primers are designed as follows (the underlined part is the enzyme cutting site):

[0024] apbgl1a-EcoR I-F TCA GAATTC GTGTCCGAGACCACCACC

[0025] apbgl1a-Hind III-R TTC AAGCT The TTCAGTCGATCGGGACGATG PCR product was digested with restriction endonucleases EcoRI and HindⅢ, ligated with the same digested vector pET28a, introduced into the Escherichia coliDH5α strain for cloning, and the clones were cultured overnight at 37°C in LB containing 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering, and particularly relates to glucose tolerance beta-glucosidase apbgl 1a and a gene and application thereof. According to the glucose tolerance beta-glucosidase apbgl 1a, the amino acid sequence of the glucose tolerance beta-glucosidase apbgl 1a is shown in SEQ ID NO.2. The glucose inhibiting constant Ki value of the glucose tolerance beta-glucosidase apbgl 1a reaches up to 1,886 mM, the most proper temperature is 45 DEG C, the most proper pH is 6.6, when the glucosidase is expressed in escherichia coli, some glucosidase can be secreted out of cells, the tolerance for SDS, ionic liquid, ethyl alcohol and the like is high, and the glucosidase can be applied to cellulosic ethanol production, feed processing, paper making, textile industry and other plant fiber hydrolytic processes.

Description

technical field [0001] The invention belongs to the field of genetic engineering, in particular to glucose tolerance beta-glucosidase apbgl1a and its gene and application. Background technique [0002] As the largest renewable plant biomass in nature, cellulose is an important raw material source for industry and bioenergy production. Cellulose molecules are polymers of glucose linked by β-1,4-glycosidic bonds. In recent years, with the energy crisis, environmental pollution and the enhancement of people's awareness of environmental protection, bioenergy produced from cellulose as a substrate, such as cellulosic ethanol, has attracted much attention. The key to utilizing cellulose is its thorough hydrolysis into fermentable sugars. In nature, the complete hydrolysis of cellulose requires the synergistic action of multiple enzymes, including endoglucanase, exoglucanase and β-glucosidase. During the hydrolysis process, the long chain of cellulose is first hydrolyzed by endo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/56C12N15/70
CPCC12N9/2445C12Y302/01021C12N15/70
Inventor 黄美娟黄海泉尹以瑞李文均黄武略闻永慧
Owner SOUTHWEST FORESTRY UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com