Application of recombinant escherichia coli with overexpression of fimH gene in fermentation production of amino acid

A technology of recombinant Escherichia coli and Escherichia coli, which is applied in the field of amino acid fermentation, can solve the problems of slow rate and achieve the effect of increasing production

Active Publication Date: 2019-08-02
NANJING UNIV OF TECH
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the use of Escherichia coli to produce threonine is widely used in microbial fermentation experiments, its rate is still relatively slow compared to the needs of the amino acid and organic acid industries

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of recombinant escherichia coli with overexpression of fimH gene in fermentation production of amino acid
  • Application of recombinant escherichia coli with overexpression of fimH gene in fermentation production of amino acid
  • Application of recombinant escherichia coli with overexpression of fimH gene in fermentation production of amino acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Embodiment 1 constructs the recombinant escherichia coli that overexpresses fimH gene

[0023] 1. Amplification of the target gene fimH: the gene fimH was amplified using the extracted Escherichia coli CIBTS1688 genome as a template. According to the fimH gene sequence of Escherichia coli str.K-12substr.MG1655 on NCBI, primers used for amplification were designed by snapgene software, wherein the primers included Xba I and Nco I restriction enzyme sites for subsequent connection with plasmid pET28a. The primers were synthesized by Jinweizhi Company in Suzhou City, Jiangsu Province.

[0024] Primer name and sequence:

[0025] fimH-F: GGATAACAATTCCCCTCTAGAATGAAACGAGTTATTACCCTGTTTG

[0026] fimH-R: GATGATGGCTGCTGCCCATGGTTATTGATAAACAAAAGTCACGCCA

[0027] The PCR reaction system is shown in Table 1.

[0028] Table 1 Target gene fimH amplification PCR system

[0029] components Volume (μL) Manufacturer 10×PCR buffer 25 μL TOYOBO Corporation dN...

Embodiment 2

[0044] Embodiment 2 constructs the recombinant escherichia coli that knocks out the fimH gene

[0045]1. Extract the knockout plasmids pKD46 and pKD4: inoculate Escherichia coli DH5α (purchased from Miaoling Plasmid Platform) Glycerol with plasmid pKD46 in 5 mL of LB liquid medium (containing 100 μg / mL ampicillin), and culture at 30°C Overnight; collect the cells in a 2.0 mL centrifuge tube, centrifuge at 10,000 rpm for 2 min, and discard the supernatant; follow the steps in the instructions of the AxyPrep Plasmid DNA Mini Kit from Corning Life Sciences to extract the plasmid pKD46. The extracted plasmids were stored at -20°C.

[0046] The formula of LB liquid medium (containing 100 μg / mL ampicillin) is as follows: yeast powder 5 g / L, peptone 10 g / L, sodium chloride 10 g / L, ampicillin 100 μg / mL.

[0047] Inoculate Escherichia coli DH5α (purchased from Miaoling Plasmid Platform) with plasmid pKD4 into 5 mL of LB liquid medium (containing 50 μg / mL kanamycin) and culture overnig...

Embodiment 3

[0059] Example 3 Gene-wide transcriptome analysis of the original strain CIBTS1688, the knockout strain CIBTS1688-ΔfimH and the overexpression strain CIBTS1688-fimH*

[0060] 1. Activation: Take CIBTS1688, CIBTS1688-ΔfimH and CIBTS1688-fimH* out of the -80°C refrigerator, prepare 5 mL of LB medium in a test tube with an inoculum size of 30 μL, and culture them in a shaker at 37°C for 12 hours at a speed of 200 rpm.

[0061] 2. Fermentation: Transfer CIBTS1688, CIBTS1688-ΔfimH and CIBTS1688-fimH* to the fermentation medium and ferment for 30 hours at 37°C respectively, then take 2mL of the fermentation broth and put it into a 2mL centrifuge tube, and quickly put it into the pre-startup setting to 4 Centrifuge in a centrifuge at 12000rpm for 2min, discard the supernatant, immediately place the centrifuge tube in liquid nitrogen for 3min, take it out and put it in a -80℃ refrigerator for use. Three parallels were prepared for each group of samples.

[0062] 3. The transcriptome ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of recombinant escherichia coli with overexpression of a fimH gene in the fermentation production of amino acid. According to the invention, by drawing lessons fromthe medical experience that compared with free cells, cells of a biological membrane formed by pathogenic escherichia coli are more adaptable to extreme environments, the formation of an escherichiacoli biological membrane can be regulated and controlled by the fimH gene regulated and controlled by a known fim operon, the change of an amino acid metabolic pathway after overexpression of the fimHgene is discovered through transcriptome analysis, groundwork is laid for screening recombination strains of other high-yield amino acid organic acid in a industrialization process in a later period,and the goal of increasing the yield, the fermentation rate and the sugar conversion rate is finally achieved.

Description

technical field [0001] The invention relates to amino acid fermentation, in particular to the application of a recombinant Escherichia coli overexpressing fimH gene in the fermentation production of amino acids. Background technique [0002] Amino acids are widely used in industrial production, such as animal feed additives, human food flavorings, and raw materials for cosmetics and medical products. In the tricarboxylic acid cycle, organic acids such as citric acid are also widely used in the fields of food additives, chemical manufacturing and medical products. At present, there are three main methods for the production of amino acids and organic acids: microbial fermentation, chemical synthesis and enzymatic method. Microbial fermentation has the advantages of wide sources of production raw materials, low cost, less environmental pollution during the production process, easy and safe operation, various strains and large-scale production, etc. mainstream method. With th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P13/14C12P13/10C12P13/20C12N15/70C12R1/19
CPCC12P13/14C12P13/10C12P13/20C12N15/70
Inventor应汉杰陈天鹏陈勇刘娜任培芳俞莹余斌柳东欧阳平凯
OwnerNANJING UNIV OF TECH