Genetically engineered cell membrane nano vesicle and preparation and application thereof

A technology of nanovesicles and genetic engineering, which is applied in the application field of preparing tumor immunotherapy drugs, can solve the problems such as difficulty in effectively activating the body's anti-tumor immune response, achieve low toxicity and side effects, achieve cascade synergy, and biocompatibility. good effect

Pending Publication Date: 2019-09-10
上海瑞可新生物科技有限公司 +1
View PDF2 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Under the pressure of immune selection, tumor cells can rely on their own hypermutability to gradually establish a variety of immunosuppressive networks (such as: down-regulation of cancer cell antigen expression, high expression of T cell inhibitory ligands, secretion of immunosuppressive molecules, induction of immunosuppressive cells Differentiation, proliferation, aggregation in tumors, hypoxic microenvironment inhibits effector lymphocyte infiltration, etc.), so targeting an immunosuppressive molecule or cell is usually difficult to effectively activate the body's anti-tumor immune response

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered cell membrane nano vesicle and preparation and application thereof
  • Genetically engineered cell membrane nano vesicle and preparation and application thereof
  • Genetically engineered cell membrane nano vesicle and preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The gene sequences of PD-1 and TRAIL proteins were respectively connected with the mCherry red fluorescent protein gene sequence and the EGFP green fluorescent protein gene sequence through a flexible peptide sequence (ggaggttctggtggatctggtggaggttctggttctggatcaggtggt) to construct a new fusion protein gene sequence.

[0039] The PD-1-mCherry gene sequence is as follows:

[0040] GCCACCATGTGGGTCCGGCAGGTACCCTGGTCATTCACTTGGGCTGTGCTGCAGTTGAGCTGGCAATCAGGGTGGCTTCTAGAGGTCCCCAATGGGCCCTGGAGGTCCCTCACCTTCTACCCAGCCTGGCTCACAGTGTCAGAGGGAGCAAATGCCACCTTCACCTGCAGCTTGTCCAACTGGTCGGAGGATCTTATGCTGAACTGGAACCGCCTGAGTCCCAGCAACCAGACTGAAAAACAGGCCGCCTTCTGTAATGGTTTGAGCCAACCCGTCCAGGATGCCCGCTTCCAGATCATACAGCTGCCCAACAGGCATGACTTCCACATGAACATCCTTGACACACGGCGCAATGACAGTGGCATCTACCTCTGTGGGGCCATCTCCCTGCACCCCAAGGCAAAAATCGAGGAGAGCCCTGGAGCAGAGCTCGTGGTAACAGAGAGAATCCTGGAGACCTCAACAAGATATCCCAGCCCCTCGCCCAAACCAGAAGGCCGGTTTCAAGGCATGGTCATTGGTATCATGAGTGCCCTAGTGGGTATCCCTGTATTGCTGCTGCTGGCCTGGGCCCTAGCTGTCTTCTGCTCAACAAGTATGTCAG...

Embodiment 2

[0045] pCDH-CMV-PD-1-mCherry-Puro and pCDH-CMV-TRAIL-EGFP-Puro use 293FT cells (from ATCC) for lentiviral packaging, the packaging process is as follows:

[0046] 1. When 293FT cells are inoculated to a density of 95-99%, they can be used for lentivirus packaging;

[0047] 2. Preparation of Tube A: Using Opti-MEM TM Dilute Lipofectamine 3000 reagent (0.96ml Opti-MEM TM Medium I: 0.96ml Lipofectamine 3000: 0.04ml)——mix well;

[0048] 3. Prepare tube B: Dilute PLP / VSVG with Opti-MEM I medium TM Lentiviral packaging plasmid and target plasmid, then add P3000 reagent (0.96ml Opti-MEM TM I culture medium: 0.96ml, PLP1: 7.5μg, PLP2: 3μg, PLP / VSVG: 4μg, target plasmid: 10μg, P3000: 0.04ml)—mix well;

[0049] 4. Incubate the newly configured tubes A and B at room temperature for 5 minutes;

[0050] 5. Add tube A to tube B and mix well, incubate at room temperature for 10-20 minutes;

[0051] 6. Add the DNA-liposome complex to the cells and shake well;

[0052] 7. At 37°C, 5% CO...

Embodiment 3

[0057] The successfully constructed stable cell lines were expanded and cultured (using DMEM medium containing 10% FBS in 5% CO 2 cultured at 37°C), the cells were scraped off with a cell scraper, collected by centrifugation, and the cell membrane was obtained according to the method provided by the cell membrane extraction kit. With PBS (0.0067M (PO 4 ) pH: 7.4) to dissolve the cell membrane, and after miscible with catalase (the cell membrane overexpressing PD1: the cell membrane overexpressing TRAIL: catalase mass ratio is 1:1:0.5), successively use 800nm, 400nm and 200nm The pore size was processed by a membrane extruder, centrifuged and washed 3 times, and nanovesicles with uniform particle size were finally obtained. Keep the whole process on ice or operate in a low temperature environment to prevent protein denaturation. The morphology of the product was characterized by TEM, and the results were as follows: figure 1 As shown in C, the results show that the particle ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Surface potentialaaaaaaaaaa
Login to View More

Abstract

The invention provides a genetically engineered cell membrane nano vesicle and preparation and an application thereof. The nano vesicle is composed of biological cell membranes, and the surface is transferred with a tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a programmed death receptor 1 (PD-1), and internal entrapment catalase (CAT). TRAIL can specifically induce tumor celldeath, release tumor antigens and "dangerous signal molecules", and triggers an immune response; the PD-1 can combines PD-L1 protein on cancer cells, and blocks related immunosuppressive pathways; andthe CAT can catalyze H2O2 of a tumor site to produce oxygen, improves a tumor hypoxic environment, and enhances infiltration of immune cells. Through organic integration of the functions, effective elimination of tumor cells and rapid activation of an autoimmune system are achieved, and a multi-point synergistic anti-tumor effect is exerted.

Description

[0001] (1) Technical field [0002] The invention relates to a genetically engineered cell membrane nanovesicle and its preparation method, as well as its application in the preparation of tumor immunotherapy drugs. [0003] (2) Background technology [0004] Tumor immunotherapy is a research hotspot in recent years. It uses immunological principles and methods to stimulate the body's internal immune response, enhance the immune rejection, inhibition and killing effect on tumor cells, so as to achieve tumor killing and reduce tumor recurrence and metastasis. the goal of. In 2013, "Science" magazine rated tumor immunotherapy as one of the top ten scientific breakthroughs of the year, and some immunotherapy drugs have been approved by the FDA for clinical use in the treatment of various malignant tumors such as melanoma, lung cancer, esophageal cancer, and leukemia . Tumor immunotherapy mainly includes adoptive immune cell therapy, cytokines, tumor vaccines, immune checkpoint i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/00A61K38/44A61K9/51A61K47/46A61P35/00C07K14/705C12N15/86
CPCA61K39/0011A61K39/001102A61K38/44A61K9/5176A61P35/00C12N15/86C07K14/70521C07K14/70575C12Y111/01006C12N2740/15043C12N2800/107C07K2319/60A61K2039/585A61K2300/00Y02A50/30
Inventor刘小龙吴名郑东烨蔡志雄苏小平
Owner上海瑞可新生物科技有限公司