Rapid and efficient locating method of tea tree plasmid type glutamine synthetase gene
A technology for glutamine and gene positioning, applied in measuring devices, instruments, fluorescence/phosphorescence, etc., can solve the problems of long experiment cycle, high operation requirements, long processing time, etc., achieve short cycle, avoid heterogeneous troubles, and can Operable and reproducible effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Localization of Plastid-type Glutamine Synthetase Gene CsGS2 in Tea Tree
[0036] (1) Cloning of the full-length cDNA of the CsGS2 gene
[0037] Take 0.1 g annual Longjing 43 ( Camellia sinensis cv.'Longjing43') cutting seedling leaves were extracted with RNAprep pure polysaccharide polyphenol plant total RNA extraction kit (Tiangen, Beijing) for total RNA extraction. The NanoDrop 2000 micronucleic acid and protein analyzer was used to measure the quality and concentration of the extracted RNA, and the integrity of the total RNA was detected by 1.2% agarose gel electrophoresis. Primers GS2-F: ATGGCACAGATTTTGGCTCCTT / GS2-R: TTAGACATTCATTGCCAGTT were designed according to the gene fragments obtained earlier. The full-length cDNA of the gene was cloned using the SMARTer™ RACE cDNA Amplification Kit from Clontech.
[0038] (2) Antibody synthesis was completed by a biological company (Hangzhou Huaan Biotechnology Co., Ltd.)
[0039] (3) The leaves of the annual cuttings...
PUM
Property | Measurement | Unit |
---|---|---|
Concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com