Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rapid and efficient locating method of tea tree plasmid type glutamine synthetase gene

A technology for glutamine and gene positioning, applied in measuring devices, instruments, fluorescence/phosphorescence, etc., can solve the problems of long experiment cycle, high operation requirements, long processing time, etc., achieve short cycle, avoid heterogeneous troubles, and can Operable and reproducible effects

Active Publication Date: 2019-11-05
TEA RES INST CHINESE ACAD OF AGRI SCI
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In order to solve the above-mentioned technical problems, the purpose of the present invention is to provide a fine positioning of tea plastid type glutamine synthetase gene GS2, to fill the existing research There is a gap in the relevant reports on tea tree GS2, and at the same time, it overcomes the problems in the prior art due to long pretreatment time, high operation requirements, and long experimental period

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid and efficient locating method of tea tree plasmid type glutamine synthetase gene
  • Rapid and efficient locating method of tea tree plasmid type glutamine synthetase gene
  • Rapid and efficient locating method of tea tree plasmid type glutamine synthetase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Localization of Plastid-type Glutamine Synthetase Gene CsGS2 in Tea Tree

[0036] (1) Cloning of the full-length cDNA of the CsGS2 gene

[0037] Take 0.1 g annual Longjing 43 ( Camellia sinensis cv.'Longjing43') cutting seedling leaves were extracted with RNAprep pure polysaccharide polyphenol plant total RNA extraction kit (Tiangen, Beijing) for total RNA extraction. The NanoDrop 2000 micronucleic acid and protein analyzer was used to measure the quality and concentration of the extracted RNA, and the integrity of the total RNA was detected by 1.2% agarose gel electrophoresis. Primers GS2-F: ATGGCACAGATTTTGGCTCCTT / GS2-R: TTAGACATTCATTGCCAGTT were designed according to the gene fragments obtained earlier. The full-length cDNA of the gene was cloned using the SMARTer™ RACE cDNA Amplification Kit from Clontech.

[0038] (2) Antibody synthesis was completed by a biological company (Hangzhou Huaan Biotechnology Co., Ltd.)

[0039] (3) The leaves of the annual cuttings...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Concentrationaaaaaaaaaa
Login to View More

Abstract

The invention provides a rapid and efficient locating method of a tea tree plasmid type glutamine synthetase gene. The method includes the steps of putting a fresh and tender tea tree leaf sample intoa PBS buffer solution on the same day of a test, slicing the sample into sections with the thickness of 50-100 micron in an oscillator slicer after the sample is embedded in and fixed by sepharose gel, hybridizing the obtained tea tree leaf transverse sections with the two antibodies (tea tree CsGS2 special antibody and commercial antibody), and finally conducting photographing under a laser scanning confocal microscope. By means of the cytology gene locating method, the gene can be rapidly, efficiently and precisely located; the gene locating can reach the cytology level; the cycle requiredin the test process is short; the heterology troubles caused by the tea tree gene locating on a model plant (arabidopsis thaliana) are avoided; safety, operability and high repeatability are realized.

Description

technical field [0001] The invention relates to the technical field of gene positioning, in particular to a fast and efficient gene positioning method for tea plastid glutamine synthetase. Background technique [0002] The organizational location of a gene largely determines its function. For example, the glutamine synthetase gene, which encodes a restriction enzyme for nitrogen metabolism in tea trees, has a cytoplasmic glutamine synthetase GS1 located in the cytoplasm and a plastid glutamine synthetase GS2 located in the chloroplast or mitochondria. The former mainly plays a role in root nitrogen metabolism, while the latter mainly resynthesizes NH from chloroplasts and photorespiration 4 + It is converted into glutamine and also participates in the synthesis of root nitrogen. Arabidopsis 5 GS1 Members respond differently to different nitrogen sources due to different expression sites, such as GLN1;1, GLN1;2 , GLN1;3 , GLN1;4 Depending on whether they are express...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/543G01N33/573G01N21/64
CPCG01N33/5438G01N33/5735G01N21/6486
Inventor 刘美雅张群峰倪康石元值马立峰伊晓云汤丹丹阮建云
Owner TEA RES INST CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com