Loop-mediated isothermal amplification detection method for detecting Fusarium oxysporum of Chinese wolfberry root rot, and detection primers and verification method thereof

Abstract

The invention discloses a loop-mediated isothermal amplification detection method for detecting Fusarium oxysporum of Chinese wolfberry root rot, and detection primers and a verification method thereof. The detection primers are designed by adopting LAMP (Loop-mediated Isothermal Amplification) design software Primer Explorer V4, and comprise two outer primers F3 and B3 and two inner primers FIP and BIP. The invention has the following beneficial effect: By the detection method, the primers and the verification method, five Fusarium oxysporum from different geographical sources is yellow green, namely positive after LAMP detection, but the control and other pathogenic bacteria are orange, namely negative. The invention has the advantages of strong primer specificity, high detection sensitivity, high reaction speed, direct observation of results by naked eyes, high accuracy, difficulty in pollution, direct detection of suspected disease samples and the like. And meanwhile, comparison and judgment are performed through color development, so that the detection accuracy is greatly improved.

Description

Technical field

[0001] The invention relates to the technical field of detection of pathogens of plant diseases, in particular to a loop-mediated isothermal amplification detection method for detecting Fusarium oxysporum of Lycium barbarum root rot, and its detection primers and verification methods. Background technique

[0002] Symptoms of Lycium barbarum root rot disease: At the initial stage of the disease, the leaves of the diseased plant are gray-green, wilting at noon, and can recover sooner or later. After that, it did not recover, and the leaves turned yellow and died slowly. The rhizome is slightly swollen, the phloem becomes reddish brown and soft, with white hyphae on the outside, and reddish-brown fine streaks on the xylem, sometimes infiltrating into the deep layer. The phloem of the tap root and lateral roots became soft and brown and died. The epidermis is longitudinally cracked, and there are many small white powdery spots in the phloem, which are easy to peel ...

Examples

Embodiment 1

[0072] The method of ring-mediated isothermal amplification detection of Lycium barbarum root rot disease of Fusarium oxysporum includes the following steps:

[0073] A. Sample collection

[0074] Collect the diseased plants of Lycium barbarum root rot, isolate the pathogenic bacteria by conventional methods indoors, and store the pathogenic bacteria at 4℃;

[0075] B. Strain culture

[0076] The pathogenic bacteria strains are cultivated on PDA medium, the formula of PDA medium is 200g potato, 20g glucose, 15-20g agar, 1000mL tap water, and culture at room temperature 25℃ under light conditions;

[0077] C. Extraction of strain genomic DNA

[0078] Adopt E.Z.N.A TM HP Fungal DNA Kit, take the hyphae cultured in step B and grind into powder under the protection of liquid nitrogen, add 600 μL of CPL buffer to the powder, add 10 μL of β-mercaptoethanol; 65°C water bath for 30 minutes, water bath During the treatment, take it out and shake it twice, add 600 μL of chloroform to prepare the...

Embodiment 2

[0104] Implementation effect 1 LAMP primer design and sequence

[0105] LAMP design software was used for primer design, including two outer primers F3 and B3, and two inner primers FIP and BIP; their sequences were F3: GTCCGAAAATTTTGCGGTGC, B3: TTCAGTGGTTA GTGACTGC, FIP: AGTGGCGGGGTAAGATACCCC, BIP: GCTTGCCCTGTTCCCACAAAAC.

[0106] Implementation effect 2 Establishment of LAMP reaction system

[0107] The optimized LAMP reaction system for detecting Fusarium oxysporum of Lycium barbarum root rot is 25μL: 10×IsothermalAmplification Buffe 2.5μL, 100mM MgSO 4 1.5μL, FIP Primer 1μL, BIPPrimer 1μL, F3Primer 1μL, B3Primer 1μL, 10mM dNTP 3.5μL, template DNA 2.5μL, 8 000U / mL Bst 2.0 DNA polymerase 1μL, ddH 2 O 10μL. By optimizing the reaction temperature, it was determined that the optimal reaction temperature of LAMP primer was 65℃. The reaction procedure is: 65°C for 1h, 80°C for 20min. Macroscopic observation of Fusarium oxysporum LAMP reaction solution is yellow-green, while the contr...

Technical field

[0001] The invention relates to the technical field of detection of pathogens of plant diseases, in particular to a loop-mediated isothermal amplification detection method for detecting Fusarium oxysporum of Lycium barbarum root rot, and its detection primers and verification methods. Background technique

[0002] Symptoms of Lycium barbarum root rot disease: At the initial stage of the disease, the leaves of the diseased plant are gray-green, wilting at noon, and can recover sooner or later. After that, it did not recover, and the leaves turned yellow and died slowly. The rhizome is slightly swollen, the phloem becomes reddish brown and soft, with white hyphae on the outside, and reddish-brown fine streaks on the xylem, sometimes infiltrating into the deep layer. The phloem of the tap root and lateral roots became soft and brown and died. The epidermis is longitudinally cracked, and there are many small white powdery spots in the phloem, which are easy to peel ...

Examples

Embodiment 1

[0072] The method of ring-mediated isothermal amplification detection of Lycium barbarum root rot disease of Fusarium oxysporum includes the following steps:

[0073] A. Sample collection

[0074] Collect the diseased plants of Lycium barbarum root rot, isolate the pathogenic bacteria by conventional methods indoors, and store the pathogenic bacteria at 4℃;

[0075] B. Strain culture

[0076] The pathogenic bacteria strains are cultivated on PDA medium, the formula of PDA medium is 200g potato, 20g glucose, 15-20g agar, 1000mL tap water, and culture at room temperature 25℃ under light conditions;

[0077] C. Extraction of strain genomic DNA

[0078] Adopt E.Z.N.A TM HP Fungal DNA Kit, take the hyphae cultured in step B and grind into powder under the protection of liquid nitrogen, add 600 μL of CPL buffer to the powder, add 10 μL of β-mercaptoethanol; 65°C water bath for 30 minutes, water bath During the treatment, take it out and shake it twice, add 600 μL of chloroform to prepare the...

Embodiment 2

[0104] Implementation effect 1 LAMP primer design and sequence

[0105] LAMP design software was used for primer design, including two outer primers F3 and B3, and two inner primers FIP and BIP; their sequences were F3: GTCCGAAAATTTTGCGGTGC, B3: TTCAGTGGTTA GTGACTGC, FIP: AGTGGCGGGGTAAGATACCCC, BIP: GCTTGCCCTGTTCCCACAAAAC.

[0106] Implementation effect 2 Establishment of LAMP reaction system

[0107] The optimized LAMP reaction system for detecting Fusarium oxysporum of Lycium barbarum root rot is 25μL: 10×IsothermalAmplification Buffe 2.5μL, 100mM MgSO 4 1.5μL, FIP Primer 1μL, BIPPrimer 1μL, F3Primer 1μL, B3Primer 1μL, 10mM dNTP 3.5μL, template DNA 2.5μL, 8 000U / mL Bst 2.0 DNA polymerase 1μL, ddH 2 O 10μL. By optimizing the reaction temperature, it was determined that the optimal reaction temperature of LAMP primer was 65℃. The reaction procedure is: 65°C for 1h, 80°C for 20min. Macroscopic observation of Fusarium oxysporum LAMP reaction solution is yellow-green, while the contr...

Images