Method for rapidly identifying transgenic or gene editing material and insertion site thereof by using whole genome resequencing data

A genome-wide, insertion site technology, applied in the field of bioinformatics, can solve the problems of reducing method sensitivity, false negative and missed detection probability, not considering recombination or disorder, time-consuming and labor-intensive, etc., and is conducive to safety risk assessment , reduce sensitivity, time-consuming effect

Active Publication Date: 2019-12-10
ZHEJIANG UNIV
View PDF8 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, none of the above-mentioned patent documents takes into account that the insertion of foreign sequences leads to recombination or disorder of sequences around the insertion site of the genome, thereby reducing the sensitivity of the method and increasing the probability of false negatives and missed detections; When the vector sequence has partial homology to the genomic sequence, false positives increase
In addition, the above methods all use the mapping between the read sequence and the wild-type genome sequence of the plant to be tested, the process is cumbersome, time-consuming and laborious

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly identifying transgenic or gene editing material and insertion site thereof by using whole genome resequencing data
  • Method for rapidly identifying transgenic or gene editing material and insertion site thereof by using whole genome resequencing data
  • Method for rapidly identifying transgenic or gene editing material and insertion site thereof by using whole genome resequencing data

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] A method for rapidly identifying gene editing materials and their insertion sites using whole genome resequencing data, the specific steps are as follows:

[0066] (1) Extraction of experimental materials and genomic DNA of plants to be tested: rice gene editing sample R07 uses pHUN4c12S as the carrier, with a full length of 12314bp, and the gene editing target gene is MTL (LOC_Os03g27610), which encodes a phospholipase.

[0067] First, according to the MTL gene sequence, design the target sequence (20nt) in the third exon of the gene, connect the target sequence into the vector pHUN4c12S, and obtain the pHUN4c12S-MTL plasmid; then, transfer the plasmid into the Agrobacterium competent; finally pass Agrobacterium-mediated transgenic method, pHUN4c12S-MTL was transferred into japonica rice variety Xidao 1. After screening, differentiation and rooting, T 0 Transgenic regenerated seedlings were planted to obtain T1 plant R07, and then the tested plant was transplanted to ...

Embodiment 2

[0102] (1) Extraction of experimental materials and genomic DNA of plants to be tested: soybean transgenic sample L22 uses pSOY19 as a vector, with a total length of 9557 bp, and the target gene g10-epsps contained in the vector functions as a glyphosate tolerance gene.

[0103] According to the g10-epsps gene sequence, the target sequence was ligated into the vector pSOY19 to obtain the pSOY19-g10-epsps expression plasmid vector; then, the plasmid was transformed into Agrobacterium competent; finally, the pSOY19 -g10-epsps was transferred into the acceptor Huachun 3. The transgenic soybean L22 was obtained after screening, differentiation and rooting.

[0104] After the strains were normally cultured to 100 days of seedling age, the leaves were taken, and the genomic DNA of the plant to be tested was extracted with a conventional DNA extraction kit, and the whole genome was resequenced. . The soybean reference genome is the cultivar Williams 82 sequence Gmax_275_v2.fa, and ...

Embodiment 3

[0137] (1) Extraction of experimental materials and genomic DNA of plants to be tested: Take rice gene editing sample R14 as an example, pHUN4c12S is used as the carrier, the full length is 12314bp, and the gene editing target gene is OsLCT1 (LOC_Os06g38120), which encodes a low-affinity ion transporter protein.

[0138] First, according to the OsLCT1 gene sequence, a target sequence (CCCGGCAGCGCACCGATGTTGCT) was designed in the third exon of the gene, and the target sequence was connected into the vector pHUN4c12S to obtain the pHUN4c12S-LCT1 plasmid; then, the plasmid was transferred into the competent Agrobacterium; Agrobacterium-mediated transgenic method, pHUN4c12S-LCT1 was transferred into japonica rice variety Tianjing 1. After screening, differentiation and rooting, T0 transgenic regenerated shoots were obtained. Continue planting to obtain T1 plant R14. After the plant to be tested is planted in the field for about 30 days, the leaves are taken, and the genomic DNA o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for rapidly identifying a transgenic or gene editing material and an insertion site thereof by using whole genome resequencing data. The method comprises the followingsteps: extracting a genome DNA; obtaining the double-end sequencing data of the whole genome; judging whether an expression vector sequence inserted into the plant to be detected and containing the T-DNA sequence is known or not; judging whether the to-be-detected plant has a transgenic event or a gene editing event or not, and whether a skeleton sequence transfer event occurs or not; and determining an insertion site of the T-DNA sequence. According to the invention, the method combines with a bioinformatics analysis means; under the condition that an expression vector is known or unknown, whether a transgenosis or gene editing event occurs or not is identified; under the condition that an expression vector is known, the accurate positioning, direction, copy number and flanking sequenceinformation of a target sequence inserted into a genome can be rapidly and accurately given; whether a skeleton sequence, namely a sequence except the target sequence, is inserted into the genome or not can also be identified, and the same positioning is given.

Description

technical field [0001] The invention relates to the technical field of bioinformatics, in particular to a method for rapidly identifying transgenic or gene editing materials and their insertion sites by using whole genome resequencing data. Background technique [0002] The method of quickly identifying transgenic materials or gene editing materials and their insertion sites refers to the "editing" or transformation of target genes in animals and plants by using transgenic technology or gene editing technology according to the principles of genetic engineering and according to people's wishes. A technology that realizes the targeted modification of the genetic traits of organisms such as the knockout and addition of specific DNA fragments. [0003] Traditional detection methods for transgenic or gene-edited exogenous gene fragments mainly include: 1. In situ hybridization: verify the integration, integrity and approximate gene copy number of the transgene; 2. Real-time fluor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G16B30/20
CPCG16B30/20G16B25/10C12Q1/6869G16B20/10C12Q1/6895C12Q1/6806
Inventor舒庆尧吴三玲谭瑗瑗高其康
OwnerZHEJIANG UNIV