Chilo suppressalis growth and development related protein ND as well as encoding gene, dsRNA interference sequence and application thereof
A technology for growth and development and interfering sequences, which is applied in the field of agricultural biology and can solve the problems of less functional mechanism and application research.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1 2
[0030] Example 1 Cloning and analysis of Nicotinamide adenine dinucleotide dehydrogenase (ND) gene of Chilo suppressalis
[0031] Weigh 20 mg of the C. borer sample and place it in a 1.5 ml enzyme-free tube. After fully grinding with a disposable enzyme-free grinding rod and liquid nitrogen, use an extraction kit to extract total RNA.
[0032] The extracted total RNA was synthesized into a cDNA template using a reverse transcription kit.
[0033] Design and synthesize the following primers:
[0034] Upstream primer sequence ND-F: 5'-ATGGTTTCTTGGAGTGCTTTGGG-3';
[0035] Downstream primer sequence ND-R: 5'-TTATTCATCTAAATTCTCACCAAGGCG-3'.
[0036] Use the above primers ND-F and ND-R to carry out PCR amplification. After the amplification is completed, use 1% agarose gel electrophoresis to identify, cut the gel and use the DNA gel recovery kit to purify and recover the target fragment.
[0037] The PCR product was connected to the pEASY-T1 vector, transformed into Escherichia c...
Embodiment 2
[0039] Example 2 The silencing efficiency of the gene after feeding the dsRNA of the ND gene and its influence on the growth and development of Chilo suppressalis
[0040] 2.1 Preparation of dsRNA template
[0041] According to the Nicotinamide adenine dinucleotide dehydrogenase (ND) gene sequence obtained in Example 1, design specific amplification primers (the 5'-end adds suitable enzyme cutting site), is used for the dsRNA of Nicotinamide adenine dinucleotide dehydrogenase (ND) gene For fragment amplification, the designed specific primers are as follows:
[0042] Upstream primer sequence ds ND-F:tg GAATTC CAACGTGTTCATTGGGCCTG
[0043] Downstream primer sequence ds ND-R:tg GGTACC TTTTGATCAGAGCATGCAAGTT.
[0044] Note: The underlined part is the EcoR I restriction site
[0045] Use the above primers ds ND-F and ds ND-R to carry out PCR amplification. After the amplification is completed, use 1% agarose gel electrophoresis to identify, cut the gel and use a DNA gel rec...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular mass | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 

