Unlock instant, AI-driven research and patent intelligence for your innovation.

Chilo suppressalis growth and development related protein ND as well as encoding gene, dsRNA interference sequence and application thereof

A technology for growth and development and interfering sequences, which is applied in the field of agricultural biology and can solve the problems of less functional mechanism and application research.

Active Publication Date: 2019-12-13
HUAZHONG AGRICULTURAL UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the prior art, the research on Nicotinamide adenine dinucleotide dehydrogenase (ND) in insects is mainly the molecular mechanism, and there are few researches on its functional mechanism and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chilo suppressalis growth and development related protein ND as well as encoding gene, dsRNA interference sequence and application thereof
  • Chilo suppressalis growth and development related protein ND as well as encoding gene, dsRNA interference sequence and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 2

[0030] Example 1 Cloning and analysis of Nicotinamide adenine dinucleotide dehydrogenase (ND) gene of Chilo suppressalis

[0031] Weigh 20 mg of the C. borer sample and place it in a 1.5 ml enzyme-free tube. After fully grinding with a disposable enzyme-free grinding rod and liquid nitrogen, use an extraction kit to extract total RNA.

[0032] The extracted total RNA was synthesized into a cDNA template using a reverse transcription kit.

[0033] Design and synthesize the following primers:

[0034] Upstream primer sequence ND-F: 5'-ATGGTTTCTTGGAGTGCTTTGGG-3';

[0035] Downstream primer sequence ND-R: 5'-TTATTCATCTAAATTCTCACCAAGGCG-3'.

[0036] Use the above primers ND-F and ND-R to carry out PCR amplification. After the amplification is completed, use 1% agarose gel electrophoresis to identify, cut the gel and use the DNA gel recovery kit to purify and recover the target fragment.

[0037] The PCR product was connected to the pEASY-T1 vector, transformed into Escherichia c...

Embodiment 2

[0039] Example 2 The silencing efficiency of the gene after feeding the dsRNA of the ND gene and its influence on the growth and development of Chilo suppressalis

[0040] 2.1 Preparation of dsRNA template

[0041] According to the Nicotinamide adenine dinucleotide dehydrogenase (ND) gene sequence obtained in Example 1, design specific amplification primers (the 5'-end adds suitable enzyme cutting site), is used for the dsRNA of Nicotinamide adenine dinucleotide dehydrogenase (ND) gene For fragment amplification, the designed specific primers are as follows:

[0042] Upstream primer sequence ds ND-F:tg GAATTC CAACGTGTTCATTGGGCCTG

[0043] Downstream primer sequence ds ND-R:tg GGTACC TTTTGATCAGAGCATGCAAGTT.

[0044] Note: The underlined part is the EcoR I restriction site

[0045] Use the above primers ds ND-F and ds ND-R to carry out PCR amplification. After the amplification is completed, use 1% agarose gel electrophoresis to identify, cut the gel and use a DNA gel rec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular massaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of agricultural biology, and particularly relates to chilo suppressalis growth and development related protein ND as well as an encoding gene, a dsRNA interference sequence and an application thereof. The chilo suppressalis growth and development related protein ND has an amino acid sequence as shown in SEQ ID NO.1. The application finds for the first time that the ND gene participates in the growth and development process of chilo suppressalis, expression deletion of the ND gene can remarkably improve the death rate of chilo suppressalis larvae, population development is finally inhibited, and the ND gene can be used for developing products for preventing and treating chilo suppressalis of pyralidae.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and specifically relates to the growth and development related protein ND of Chilo suppressalis borer and its coding gene, dsRNA interference sequence and application. Background technique [0002] Chilo suppressalis (Chilo suppressalis) belongs to the family Lepidoptera and is an important polyphagous agricultural pest. It mainly harms rice, wild rice stem, corn, wheat and other plants, especially for early-planted, densely grown fields and Hybrid rice fields are more dangerous. At present, the control of Chilo borer is mainly based on the application of chemical pesticides. However, the long-term and large-scale use of chemical pesticides has caused problems such as environmental pressure and drug resistance. In order to change this situation, the development and utilization of pollution-free control measures for rice pests that meet the concepts of environmental protection, health, g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/53C12N15/113A01N57/16A01P7/04
CPCA01N57/16C12N9/0036C12N2310/14C12Y106/99003
Inventor 马伟华金慧慧李昌焱陈浩林拥军
Owner HUAZHONG AGRICULTURAL UNIVERSITY