Kit for detecting bloodstream infectious pathogen nucleic acids in plasma

A free nucleic acid and pathogen technology, which is applied in the field of kits for detecting free nucleic acid of bloodstream infection pathogens in plasma by using QPCR technology, and a kit for detecting free nucleic acid of bloodstream infection pathogens in plasma, which can solve the problem of low content of pathogenic microorganisms and restricted products. Application, influence sensitivity and other issues, to achieve the effect of high sensitivity, low solution efficiency, and easy operation

Active Publication Date: 2020-01-21
AUTOBIO DIAGNOSTICS CO LTD
View PDF8 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the low content of pathogenic microorganisms in blood, the detection of pathogenic microorganism DNA is interfered by a large number of red blood cells, hemoglobin, white blood cells, and human genome in whole blood samples, which seriously affects the sensitivity of detection.
Biofire's marketed products for the detection of bloodstream infection pathogens use molecular detection technology, which is only used for the detection of pathogenic microorganisms in positive cultures after culture. limit its product application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting bloodstream infectious pathogen nucleic acids in plasma
  • Kit for detecting bloodstream infectious pathogen nucleic acids in plasma
  • Kit for detecting bloodstream infectious pathogen nucleic acids in plasma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Extraction of bloodstream infection pathogen free nucleic acid in the plasma sample of embodiment 1

[0032] Use a sterile 5ml centrifuge tube to collect 1.2ml of K2EDTA-treated human plasma samples, and use QIAamp Circulating Nucleic Acid Kit from QIAAMP for extraction. The operation steps are carried out according to the instructions. After extraction, the nucleic acid is placed at -75°C Save the following for later use.

Embodiment 2

[0033] Embodiment 2, primer, probe optimization experiment

[0034] Because cell-free DNA is all short fragments, the abundance of different target sequences in plasma varies. Different target gene sequences were designed for Klebsiella pneumoniae, Aspergillus flavus, and Pseudomonas aeruginosa, and the lengths of amplified fragments were different. The plasma of positive patients was used to extract free DNA and screen primers and probes.

[0035] Table 1 Screening sequences of primers and probes

[0036]

[0037] For the same sample, the smaller the detection Ct value, the higher the detection sensitivity of the primer and probe combination. According to the results in Table 1, highly sensitive primers and probes were determined, and their sequences are shown in Table 2.

[0038] Table 2 highly sensitive primers and probe sequences

[0039]

[0040]

Embodiment 3

[0041] Embodiment 3, the preparation of Klebsiella pneumoniae, Aspergillus flavus, Pseudomonas aeruginosa triple nucleic acid detection kit

[0042] The primers and probe sequences in the kit are shown in Table 2.

[0043] The kit also includes internal standard primers and internal standard probes, the sequences of which are as follows:

[0044] Internal standard forward primer: 5'-3'gatgaagttggtggtgaggcc (SEQ ID NO: 11);

[0045] Internal standard reverse primer: 5'-3'tgcccagtttctattggtctcc (SEQ ID NO: 12);

[0046] Internal standard probe: 5'-3'gttccaccagaaaaaggaaccagacagg (SEQ ID NO: 13);

[0047] The kit also includes: 10mM dNTPs, 5U / μl Taq enzyme, 50mM MgCl 2 . The kit also includes a negative control (sterile water) and a positive control (artificially synthesized at a concentration of 1×10 6 Copies / ml of pseudovirus).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of biology and discloses a kit and detection method for detecting bloodstream infectious pathogen nucleic acids. The kit for detecting bloodstream infectious pathogen nucleic acids in plasma comprises a primer group for amplifying the target sequence of free DNA of bloodstream infectious pathogen and a detection probe. The kit has excellent specificityon the DNA of free nucleic acids of bloodstream infectious pathogens, including klebsiella pneumoniae, aspergillus flavus and pseudomonas aeruginosa, in a plasma sample, and can realize quick, accurate and sensitive identification on bloodstream infectious pathogens, including klebsiella pneumoniae, aspergillus flavus, pseudomonas aeruginosa and the like, in the plasma sample. The kit and detection method are simple and convenient in operation and have good detection specificity, high sensitivity and wide detection range. Experiments indicate that the kit has the limit of detection for detecting the klebsiella pneumoniae, aspergillus flavus and pseudomonas aeruginosa respectively being 0.2, 0.4 and 0.3CFU/ml.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a kit for detecting free nucleic acid of bloodstream infection pathogens in plasma, in particular to a kit for detecting free nucleic acid of bloodstream infection pathogens in plasma using QPCR technology. Background technique [0002] Bloodstream infection (BSI) is one of the clinically severe infectious diseases. According to different symptoms, it can be divided into sepsis, sepsis and septic shock. Bloodstream infection is caused by pathogenic bacteria invading the blood system, growing and multiplying in the blood, producing a large amount of toxins and causing acute systemic infection, with high morbidity and fatality rates. Common sources of infection include bacteria and fungi. [0003] Currently, there is a lack of rapid and accurate detection methods for bloodstream infections. The gold standard for the diagnosis of bloodstream infections is blood culture, which identifie...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/686C12Q1/04C12N15/11C12R1/22C12R1/67C12R1/385
CPCC12Q1/689C12Q1/686C12Q2561/113C12Q2563/107C12Q2545/114Y02A50/30
Inventor 高利飞高歌郑业焕李静静李振红付光宇吴学炜苗拥军
Owner AUTOBIO DIAGNOSTICS CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap