Application of rice tRNA prenyltransferase gene osipt9 in resistance to brown planthopper in rice

A technology against brown planthopper and isopentenyl, which is applied in the field of plant genetic engineering and can solve the problems of failing to detect cZ

Active Publication Date: 2021-07-20
WUHAN UNIV +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that AtIPT2 exhibits tRNA-IPT activity in vitro; double mutants of AtIPT2 and AtIPT9 failed to detect cZ in vivo (Miyawaki et al., 2006)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rice tRNA prenyltransferase gene osipt9 in resistance to brown planthopper in rice
  • Application of rice tRNA prenyltransferase gene osipt9 in resistance to brown planthopper in rice
  • Application of rice tRNA prenyltransferase gene osipt9 in resistance to brown planthopper in rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] [Example 1] Acquisition of rice OsIPT9 gene

[0036] A tRNA isopentenyltransferase OsIPT9 was found by screening interacting proteins in the rice 9311 library against the brown planthopper gene Bph6, and the ORF sequence and genome sequence of the gene were amplified in the cDNA of Nipponbare by designing primers.

Embodiment 2

[0037] [Example 2] Subcellular localization of rice OsIPT9 gene

[0038] Primers were designed at both ends of the full-length ORF of the OsIPT9 gene, and BamHI restriction sites and protective bases were added. After the amplified fragment was recovered, it was digested with BamHI enzyme and connected to the vector PCXUN::GFP digested with the same enzyme. , The positive clones were sent for sequencing, and it was confirmed that there was no mutation in the forward connection to extract the plasmid, and the plasmid was transformed into protoplasts. The specific process is as follows:

[0039] The rice seeds were sown in 1 / 2 MS medium, and cultured in a dark incubator at 28°C for 10 to 12 days. Take about 100 seedlings, cut the stems into small pieces of about 0.5mm with a blade, equilibrate in 0.6M mannitol for 10 minutes, transfer them to the enzymatic hydrolysis solution, and culture them in the dark at 28°C and 80rpm for 4-5h. Add 10 ml of W5 solution to the enzymolysis ...

Embodiment 3

[0040] [Example 3] Overexpression of OSIPT9 gene, construction of CRISPR / Cas9 vector and genetic transformation mediated by Agrobacterium

[0041] 1. Construction of OsIPT9 overexpression vector

[0042] The inventors intercepted a section of primers at both ends of the ORF of OsIPT9, and the sequence is as follows:

[0043] OEV-F:ATGGCCCACCTCGCGGCCTCTG(5'-3')

[0044] OEV-R:CTATAATGATATCACTGTACTAGCC(5'-3')

[0045] The vector used is pCXUN (provided by Professor Wang Guoliang of Ohio State University in the United States). The pCXUN vector is cut with XcmI, and the foreign fragment can be directly connected after adding A. According to the sequence of SEQ ID No.2, the ORF was directly amplified by PCR, and connected to the vector after adding A. After the sequence verification is correct, the obtained vector is the OsIPT9 gene overexpression vector, which is electrotransformed into Agrobacterium EHA105. Pick a single clone for expansion and culture, and after PCR verifica...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of rice tRNA isopentenyl transferase gene OsIPT9 in rice resistance to brown planthopper. It belongs to the field of plant genetic engineering technology. OsIPT9 It has the amino acid sequence shown in SEQ ID No.1, the nucleotide sequence shown in SEQ ID No.2, and the ORF sequence shown in SEQ ID No.3. Through Agrobacterium-mediated genetic transformation, the OsIPT9 Transplanted into Nipponbare, which is susceptible to N. lugens, the overexpressed plants have enhanced resistance to N. lugens; at the same time, the resistant material NIP‑Bph6‑NIL was knocked out by CRISPR / Cas9 technology OsIPT9 , resulting in a significant down-regulation of plant resistance to N. lugens. The gene of the invention provides a good theoretical basis for studying the gene interaction between rice and brown planthopper, and has reference significance for studying gene molecular function and breeding.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to the application of rice tRNA isopentenyl transferase gene OsIPT9 in rice resistance to brown planthopper. Background technique [0002] Rice (Oryza sativa) is one of the most important food crops in my country. Rice production is directly related to my country's food security, farmers' income increase and rural stability. Rice planthopper is the primary pest that occurs and causes the largest damage in rice production. The rice planthoppers that harm rice mainly include brown planthopper, white-backed planthopper and brown planthopper, among which brown planthopper is the main one. Brown planthopper (BPH; Nilaparvata ) is a typical piercing-sucking insect type. The brown planthopper can cause direct damage and indirect damage to rice. The direct damage is caused by the needle-like mouthparts piercing and sucking the phloem juice of rice (Wang et al., 2008;...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/82A01H5/00A01H5/10A01H6/46
CPCC12N9/1085C12N15/8286C12Y205/01075
Inventor何光存郭建平杜波陈荣智祝莉莉
OwnerWUHAN UNIV