Method for improving production efficiency of D-tyrosine

A tyrosine and amino acid technology is applied in the field of improving the production efficiency of D-tyrosine, which can solve the problems of low conversion rate of L-tyrosine, and achieve the effects of high optical purity, strong specificity and low cost of products.

Inactive Publication Date: 2020-03-31
JIANGNAN UNIV
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few reports on the production of D-tyrosine by enzymatic conversion. There are literatures that use L-amino acid deaminase derived from Proteus mirabilis and D-amino acid dehydrogenase derived from thermophilic symbiotic bacteria to convert L-tyrosine to produce D-tyrosine and to regenerate the coenzyme NADPH using a stable Burkholderia-derived formate dehydrogenase
But the conversion rate of L-tyrosine in this cascade system is low, only 45.3%

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving production efficiency of D-tyrosine
  • Method for improving production efficiency of D-tyrosine
  • Method for improving production efficiency of D-tyrosine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: Construction of recombinant plasmid pRSFDuet-1-PmLAAD

[0032] The artificially synthesized PmLAAD gene (nucleotide sequence shown in SEQ ID NO: 1) containing SacI and SalI restriction sites through codon optimization, the PmLAAD gene and the plasmid pRSFDuet- Digest at 137°C for 2 hours, use T 4 The PmLAAD gene and plasmid pRSFDuet-1 after enzyme digestion and gel recovery were ligated with ligase for 10 hours at 16°C, and the ligated products were transformed into E.coli JM109 competent cells by chemical transformation, and cultured on LB plates containing kanamycin for 12 hours , and verify the colonies grown on the plate by PCR. Positive transformants were selected and inoculated in LB medium, cultured at 37°C for 12 hours, and plasmids were extracted. After sequencing verification, the recombinant plasmid pRSFDuet-1-PmLAAD was constructed.

Embodiment 2

[0033] Example 2: Construction of recombinant plasmid pACYCDuet-1-CgDAPDH

[0034] The artificially synthesized CgDAPDH gene (nucleotide sequence shown in SEQ ID NO: 2) containing EcoRI and SalI restriction sites through codon optimization, the CgDAPDH gene and the plasmid pACYCDuet- 1 Digest for 2 hours at 37°C, use T 4Ligase ligated the CgDAPDH gene and plasmid pACYCDuet-1 after digestion and gel recovery at 16°C for 10 hours, and transformed the ligation product into E.coli JM109 competent cells by chemical transformation method, and cultured them on LB plates containing chloramphenicol for 12 hours. Colonies grown on the plate were verified by PCR. Positive transformants were selected and inoculated in LB medium, cultured at 37°C for 12 hours, and plasmids were extracted. After sequencing verification, the recombinant plasmid pACYCDuet-1-CgDAPDH was constructed.

Embodiment 3

[0035] Example 3: Construction of recombinant plasmid pACYCDuet-1-CgDAPDH-BmGDH

[0036] Using the genome of Bacillus megaterium as a template, with 5,ga agatct catgtataaagattagaagg3, as forward primer, with 5, ccg ctcgag ttatccgcgtcctgcttg3, the BmGDH gene (nucleotide sequence shown in SEQ ID NO: 3) is amplified for the reverse primer (the underlined part is the restriction site of BglII and XhoI respectively), and the restriction endonuclease BglII and XhoI are used Digest the BmGDH gene and the plasmid pACYCDuet-1-CgDAPDH constructed in Example 2 at 37°C for 2 hours, and use T 4 The BmGDH gene and the plasmid pACYCDuet-1-CgDAPDH after digestion and gel recovery were ligated with ligase at 16°C for 10 hours, and the ligated product was transformed into E.coli JM109 competent cells by chemical transformation, and cultured on LB plates containing chloramphenicol After 12 hours, the colonies grown on the plate were verified by PCR. Positive transformants were selected and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving production efficiency of D-tyrosine, which belongs to the technical field of bioengineering. A double-plasmid co-expression recombinant bacterium is constructed through a molecular biological means, efficient expression of three enzymes is achieved at the same time, L-tyrosine is converted into D-tyrosine, NADP<+> is converted into NADPH through a coupling coenzyme regeneration system, and NADPH cyclic regeneration and conversion can be efficiently conducted, the efficient production of D-tyrosine is realized by optimizing whole-cell transformation conditions. The yield of the D-tyrosine produced by the method can reach 8.4 g / L, and the conversion rate reaches 93%.

Description

technical field [0001] The invention relates to a method for improving the production efficiency of D-tyrosine, which belongs to the technical field of bioengineering. Background technique [0002] D-tyrosine is a non-natural chiral amino acid, which is an important intermediate of peptide drugs and anti-tumor chiral drugs. Atosiban, polypeptide, anisomycin and other substances can be synthesized by using D-tyrosine as a chiral precursor. Among them, atosiban is a kind of tocolytic; polypeptide has special curative effect in the treatment of malignant tumors; Anisomycin is anti-protozoal, anti-fungal, anti-amoeba and anti-tumor. [0003] At present, the synthesis methods of D-tyrosine mainly include chemical resolution, biological resolution and enzymatic conversion. The chemical resolution method faces the problems of expensive resolution reagents, harsh reaction conditions, and low product yields. The biological resolution method is to use ordinary denatured bacillus ce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12P13/22C12R1/19
CPCC12N9/0006C12N9/0022C12N15/70C12P13/225C12Y101/9901C12Y104/03002C12Y104/99001
Inventor刘立明王金辉刘佳宋伟陈修来高聪罗秋玲
OwnerJIANGNAN UNIV