Unlock instant, AI-driven research and patent intelligence for your innovation.

Bifidobacterium lactis capable of preventing osteoporosis and application of bifidobacterium lactis capable of preventing osteoporosis

A technology of bifidobacterium lactis and living bacteria, applied in the field of microbiology, to achieve the effect of preventing and treating osteoporosis, with wide application prospects

Active Publication Date: 2020-04-07
INNER MONGOLIA YILI INDUSTRIAL GROUP CO LTD
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, after investigation, there are few technical reports on the use of Bifidobacterium lactis for the treatment and / or prevention of osteoporosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bifidobacterium lactis capable of preventing osteoporosis and application of bifidobacterium lactis capable of preventing osteoporosis
  • Bifidobacterium lactis capable of preventing osteoporosis and application of bifidobacterium lactis capable of preventing osteoporosis
  • Bifidobacterium lactis capable of preventing osteoporosis and application of bifidobacterium lactis capable of preventing osteoporosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1: Bifidobacterium lactis BL-99 and performance measurement thereof

[0043] The Bifidobacterium lactis BL-99 of the present invention is from Shanghai Jiaoda Only Co., Ltd., and is isolated from the intestinal tract of infants. The strain was preserved in China General Microorganism Culture Collection and Management Center CGMCC on April 26, 2018 (Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), taxonomic name: Bifidus lactis Bacillus (Bifidobacterium lactis); the deposit number is CGMCC No.15650.

[0044] 1. Taxonomic characteristics of Bifidobacterium lactis BL-99

[0045] Physical and chemical test results:

[0046]

[0047] 16S rRNA gene sequence sequencing results (SEQ ID No.1):

[0048] GCTCCCCCACAAGGGTCGGGCCACCGGCTTCGGGTGCTACCCACTTTCATGACTTGACGGGCGGTGTGTACAAGGCCCGGGAACGCATTCACCGCGGCGTTGCTGATCCGCGATTACTAGCGACTCCGCCTTCACGCAGTCGAGTTGCAGACTGCGATCCGAACTGAGACCGGTTTTCAGC...

Embodiment 2

[0062] Example 2: Ovariectomized Rat Animal Model and Probiotic Intervention

[0063] After culturing Bifidobacterium lactis BL-99 in MRS liquid medium at 37°C for 16 hours, centrifuge at 4°C and 2500rpm for 10 minutes to collect the bacteria, wash with phosphate buffered saline (PBS) and freeze-dry at -18°C Save below. Used in the experimental research of Embodiment 2-Embodiment 5 of the present invention.

[0064] Eighty-five 17-week-old female adult SD rats, weighing 200-300g. Rats were randomly divided into 3 groups, 10 in each group. Twenty rats underwent ovariectomy, and the remaining 10 rats underwent sham surgery. The rats had 12 hours of light / dark per day, the room temperature was around 25°C, and they had free access to drinking water. After 12 weeks of surgical intervention, the animals in the model observation group were sacrificed, and samples such as uterus, femur, and tibia were collected, and related indicators of osteoporosis, such as uterine coefficient,...

Embodiment 3

[0070] Example 3: Bone Histomorphometry Measurements

[0071] Take the proximal 1 / 3 of the left tibia, cut it longitudinally along the sagittal plane, and take about 1×0.5×0.5cm 3 , soak in decalcification solution 10% EDTA / PBS (pH7.4) until complete decalcification, about 1 week, change the solution every 3 days, then routine dehydration, paraffin embedding, along the sagittal plane (thickness 4μm) , HE staining, and the pathological image analyzer can be used to measure the total tissue area, trabecular bone area, and total perimeter of trabecular bone, and then use the calculation formula to convert the percentage of trabecular bone area, number of trabecular bone, trabecular bone thickness and bone Trabecular separation. Bone tissue slices were also used to observe the appearance, arrangement, and morphological integrity of bone trabeculae.

[0072] After 12 weeks of probiotic BL-99 intervention, HE staining results ( Figure 2A ), the trabeculae in the sham operation g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides bifidobacterium lactis (Bifidobacterium lactis) capable of preventing osteoporosis and an application of the bifidobacterium lactis capable of preventing osteoporosis, and belongs to the technical field of microorganisms. The bifidobacterium lactis provided by the invention has properties of being resistant to gastric acid and intestinal juice, when the bifidobacterium lactis is treated for 30min in gastric acid liquid having pH being 2.5, the survival rate of viable bacteria is 62% or above, when the bifidobacterium lactis is treated for 2 hours, the survival rate of the viable bacteria is 61% or above, and when the bifidobacterium lactis is treated for 2 hours in small intestine liquid having pH being 6.8, the survival rate of the viable bacteria is 70% or above. The bifidobacterium lactis can significantly reduce loss of bone mass caused by lack of estrogen, promote blood calcium and blood phosphorus, restrain the number of in vivo osteoclasts, restrain the absorption effects of the in vivo osteoclasts on bones, and increase the level of protein through promoting the expression protein of bone synthesis and metabolism correlation factor genes so as to promote formation of new bones. The strain disclosed by the invention can be used for preparing foods and the like capable of preventing osteoporosis, and has great application prospects.

Description

technical field [0001] The invention relates to the technical field of microbes, in particular to a strain of Bifidobacterium lactis which has the functions of preventing osteoporosis, increasing blood calcium ions and / or phosphorus ions, and the like. Background technique [0002] Osteoporosis is a systemic metabolic skeletal disease characterized by decreased bone mass and destruction of bone microstructure. It is manifested by increased bone fragility, which can easily induce fractures. About 200 million people worldwide suffer from osteoporosis. As the incidence of hip fractures due to osteoporosis is increasing worldwide, the elderly population is largely affected by fracture risk. The total number of people with disabilities worldwide is 5.8 million per year. Fifty-one percent of this figure was due to fractures, mainly in Europe and the Americas. Consequently, osteoporotic fractures are considered to be an important cause of mortality and morbidity in developed co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A61K35/745A61P19/10A23L33/135A23L2/39A23K10/18A23C9/13A23C9/152A23C9/16A23C19/06C12R1/01
CPCC12N1/20A61P19/10A23L33/135A23L2/39A23K10/18A23C9/13A23C9/152A23C9/16A23C19/061A61K2035/115A23V2002/00C12R2001/01C12N1/205A23V2400/531A23V2200/306Y02A50/30
Inventor 冯昊天菲利普·韦斯科姆刘伟贤洪维鍊司徒文佑李昊虬
Owner INNER MONGOLIA YILI INDUSTRIAL GROUP CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More