Overexpressed UTP-glucose-1-phosphate-uridine transferase gene, and construction method and application of recombinant engineering bacterium of overexpressed UTP-glucose-1-phosphate-uridine transferase gene

A technology of recombinant engineering bacteria, UTP-, applied in the field of bioengineering and microbial fermentation, can solve the problems affecting the growth of Staphylococcus carnosus or Lactococcus lactis, enzyme activity and freeze-drying survival rate, etc., and achieve the effect of improving the growth of bacteria

Pending Publication Date: 2020-04-17
NINGBO UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are many reports on improving plant growth in plants by overexpression technology, and the gene of Lactobacillus acidophilus encoding UTP-glucose-1-phosphate-uridine transferase is overexpressed in Staphylococcus carnus or Lactococcus lactis, and It has not been reported that it affects the growth, enzyme activity and freeze-drying survival rate of Staphylococcus carnosus or Lactococcus lactis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Overexpressed UTP-glucose-1-phosphate-uridine transferase gene, and construction method and application of recombinant engineering bacterium of overexpressed UTP-glucose-1-phosphate-uridine transferase gene
  • Overexpressed UTP-glucose-1-phosphate-uridine transferase gene, and construction method and application of recombinant engineering bacterium of overexpressed UTP-glucose-1-phosphate-uridine transferase gene
  • Overexpressed UTP-glucose-1-phosphate-uridine transferase gene, and construction method and application of recombinant engineering bacterium of overexpressed UTP-glucose-1-phosphate-uridine transferase gene

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment 1

[0038] A strain overexpressing the UTP-glucose-1-phosphate-uridine transferase gene (LBA1719) from Lactobacillus acidophilus ( Lactobacillus acidophilus ) ATCC 4356 gene encoding UTP-glucose-1-phosphate-uridine transferase, the nucleotide sequence of which is shown in SEQ ID No: 1 in the sequence listing.

specific Embodiment 2

[0040] Construction of recombinant expression vector pMG-LBA1719

[0041] 1. Lactobacillus acidophilus ( Lactobacillus acidophilus ) ATCC 4356 genomic DNA as a template, design PCR primers to amplify UTP-glucose-1-phosphate-uridine transferase (LBA1719) gene fragment, its nucleotide sequence is shown in SEQ ID No: 1 in the sequence table; PCR primers The sequence of the LBA1719 upstream amplification primer: TCGACCTGCAGGCATGCAATGCACCATCATCATCATATGAAAGTAAGAAAAGCCATC; LBA1719 Downstream amplification primer: GTTTTCAGACTTTGCAAGCTTTATTCCTTTTCAAGCTTCTT.

[0042] 2. Lactobacillus acidophilus ( Lactobacillus acidophilus ) Genomic DNA of ATCC 4356 (the Lactobacillus acidophilus has been preserved in the China Common Microorganism Culture Collection and Management Center, the registration number of which is 1.1878) was used as a template, and the following PCR amplification reaction was performed: (1) 94°C for 4 minutes; ( 2) 98°C for 10sec, 60°C for 5sec, 72°C for 1min; repeat 30 ...

specific Embodiment 3

[0047] 1. Genetically engineered bacteria of Staphylococcus carnosus S. aureus -2, S. aureus -0 builds

[0048] The pMG-LBA1719 overexpression plasmid prepared in Example 2 was extracted and concentrated by a plasmid mini-extraction kit (EM101-01, Beijing Quanshijin Biotechnology Co., Ltd.), and then transformed into Staphylococcus rongeosa by electric shock and recovered at 37°C. After 2 hours, smear the erythromycin-resistant plate, then culture at 37°C for 36 hours, and screen the transformants. The transformants are verified by PCR, so as to obtain the recombinant meat that overexpresses the UTP-glucose-1-phosphate-uridine transferase gene LBA1719. staphylococcus S. aureus -2. At the same time, the untreated expression vector pMG36e was extracted and concentrated by a plasmid mini-extraction kit, then transformed into Staphylococcus carnus by electric shock, recovered at 37°C for 2 hours, coated with erythromycin-resistant plates, and then cultured at 37°C for 36 hou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an overexpression UTP-glucose-1-phosphate-uridine transferase gene, and a construction method and an application of a recombinant engineering bacterium of the overexpression UTP-glucose-1-phosphate-uridine transferase gene. The gene is a Lactobacillus acidophilus ATCC 4356 gene from a gene for encoding the UTP-glucose-1-phosphate-uridine transferase, and the nucleotide sequence of the overexpression UTP-glucose-1-phosphate-uridine transferase gene is represented by SEQ ID No:1 in a sequence table. The construction method comprises the following steps: the UTP-glucose-1-phosphate-uridine transferase gene segment of Lactobacillus acidophilus ATCC4356 is cloned and is connected to a pMG36e expression vector, the obtained substance is introduced to Staphylococcus carnosus or Lactococcus lactis by using an electric conversion method, and erythromycin resistance screening and identification are performed to obtain the recombinant engineering strain with the target gene, that is the engineering bacterium of the overexpressed UTP-glucose-1-phosphate-uridine transferase gene. The construction method has the advantages of significantly improving bacterial growth, enzyme activity and the freeze-drying survival rate.

Description

technical field [0001] The invention belongs to the technical field of bioengineering and microbial fermentation, and in particular relates to the construction method and application of the overexpressed UTP-glucose-1-phosphate-uridine transferase gene and its recombinant engineering bacteria. Background technique [0002] Staphylococcus meatus is oval or spherical, nonflagellated, immobile, and is classified as thrombin-positive or negative. Among them, Staphylococcus aureus is the prototype species of coagulase-positive staphylococcus, which is a pathogen of medical and veterinary importance; thrombin-negative staphylococcus has Staphylococcus flesh. Compared with other Staphylococci, Staphylococcus carnosus does not produce hemolysin, toxins, etc., and is recognized as a food-grade strain in the Staphylococcus genus. Staphylococcus carnus can produce different enzymes, such as nitrate reductase, catalase, superoxide dismutase, lipase and protease, which affect the color ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N15/74C12N1/21C12N1/04C12R1/44C12R1/01
CPCC12N9/1241C12N15/746C12N15/74C12N1/04C12Y207/07009
Inventor曾小群孙洁潘道东夏超然吴振蔡振东刘明学程璐
OwnerNINGBO UNIV