Overexpressed UTP-glucose-1-phosphate-uridine transferase gene, and construction method and application of recombinant engineering bacterium of overexpressed UTP-glucose-1-phosphate-uridine transferase gene
A technology of recombinant engineering bacteria, UTP-, applied in the field of bioengineering and microbial fermentation, can solve the problems affecting the growth of Staphylococcus carnosus or Lactococcus lactis, enzyme activity and freeze-drying survival rate, etc., and achieve the effect of improving the growth of bacteria
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment 1
[0038] A strain overexpressing the UTP-glucose-1-phosphate-uridine transferase gene (LBA1719) from Lactobacillus acidophilus ( Lactobacillus acidophilus ) ATCC 4356 gene encoding UTP-glucose-1-phosphate-uridine transferase, the nucleotide sequence of which is shown in SEQ ID No: 1 in the sequence listing.
specific Embodiment 2
[0040] Construction of recombinant expression vector pMG-LBA1719
[0041] 1. Lactobacillus acidophilus ( Lactobacillus acidophilus ) ATCC 4356 genomic DNA as a template, design PCR primers to amplify UTP-glucose-1-phosphate-uridine transferase (LBA1719) gene fragment, its nucleotide sequence is shown in SEQ ID No: 1 in the sequence table; PCR primers The sequence of the LBA1719 upstream amplification primer: TCGACCTGCAGGCATGCAATGCACCATCATCATCATATGAAAGTAAGAAAAGCCATC; LBA1719 Downstream amplification primer: GTTTTCAGACTTTGCAAGCTTTATTCCTTTTCAAGCTTCTT.
[0042] 2. Lactobacillus acidophilus ( Lactobacillus acidophilus ) Genomic DNA of ATCC 4356 (the Lactobacillus acidophilus has been preserved in the China Common Microorganism Culture Collection and Management Center, the registration number of which is 1.1878) was used as a template, and the following PCR amplification reaction was performed: (1) 94°C for 4 minutes; ( 2) 98°C for 10sec, 60°C for 5sec, 72°C for 1min; repeat 30 ...
specific Embodiment 3
[0047] 1. Genetically engineered bacteria of Staphylococcus carnosus S. aureus -2, S. aureus -0 builds
[0048] The pMG-LBA1719 overexpression plasmid prepared in Example 2 was extracted and concentrated by a plasmid mini-extraction kit (EM101-01, Beijing Quanshijin Biotechnology Co., Ltd.), and then transformed into Staphylococcus rongeosa by electric shock and recovered at 37°C. After 2 hours, smear the erythromycin-resistant plate, then culture at 37°C for 36 hours, and screen the transformants. The transformants are verified by PCR, so as to obtain the recombinant meat that overexpresses the UTP-glucose-1-phosphate-uridine transferase gene LBA1719. staphylococcus S. aureus -2. At the same time, the untreated expression vector pMG36e was extracted and concentrated by a plasmid mini-extraction kit, then transformed into Staphylococcus carnus by electric shock, recovered at 37°C for 2 hours, coated with erythromycin-resistant plates, and then cultured at 37°C for 36 hou...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com