Recombinant strain and application thereof

A technology for recombining strains and strains, applied in the field of bioengineering, can solve problems such as unfavorable by-products, unsatisfactory yield, etc., and achieve the effects of increasing fermentation yield, improving survival rate and cell state, and increasing yield

Active Publication Date: 2020-04-24
HEC PHARM
View PDF9 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0013] The inventors of the present application have provided an improved recombinant shikimic acid for the problems that antibiotics and inducers need to be added in the production process of the existing microbial synthesis of shikimic acid, and the yield is not ideal, and too many by-products are not conducive to industrial production. Production strain and preparation method thereof

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant strain and application thereof
  • Recombinant strain and application thereof
  • Recombinant strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0104] Example 1 Construction of Escherichia coli CRISPR-Cas9 system

[0105] The Escherichia coli CRISPR-Cas9 system consists of two basic plasmids, pCas-lac and pTargetF, which were constructed according to the method in the literature "Multigene Editing in the Escherichia coli Genomeviathe CRISPR-Cas9 System". Plasmid pCas-lac is an episomal plasmid of Escherichia coli, which contains L-arabinose-induced expression of Red recombinase element, Cas9 protein coding gene Cas9, temperature-sensitive element, sgRNA used for induction and elimination of plasmid pTargetF, and kanamycin resistance Gene KanR et al. All plasmid series containing pCas-lac derivatives need to be cultured at 30°C to ensure normal replication of the plasmid without loss.

[0106] Plasmid pTargetF is an Escherichia coli episomal plasmid, containing the spectinomycin resistance gene aadA and the promoter pJ23119 for transcription of sgRNA, see the plasmid map image 3 .

[0107] According to the sequence...

Embodiment 2

[0129] Example 2 Construction of Escherichia coli BL21ΔaroL (ESA-1) Engineering Bacteria

[0130] Primers were designed according to the upstream and downstream sequences of Escherichia coli BL21(DE3) aroL gene. According to the genome sequence of Escherichia coli BL21(DE3) published on NCBI, the sequence of shikimate kinase aroL was found, the cleavage site N20 was selected on the aroL gene, and the upstream homology arm and downstream homology arm of aroL knockout were amplified by PCR , the primers are as follows:

[0131] Amplification of aroL upstream homology arm primers

[0132] SA-001: GGTATAGTAAGGGGTGTATTGAG

[0133] SA-002: ACAAATAAACCACGATCCCGAGGGCCATTCCGACCGTTGT

[0134] Primers used to amplify the downstream homology arm of aroL

[0135] SA-003-aroL: ACAACGGTCGGAATGGCCCTCGGGATCGTGGTTTATTTGT

[0136] SA-004-aroL: GACGCAGATCCCTTGTAGTG

[0137] Amplification of DonorDNA

[0138]

[0139] Primer annealing yields the cleavage site N20-sequence:

[0140] SA-0...

Embodiment 3

[0144] Example 3 Construction of Escherichia coli BL21ΔptsHIcrrΔaroL (ESA-2) Engineering Bacteria

[0145] Primers were designed according to the upstream and downstream sequences of Escherichia coli BL21(DE3) ptsHIcrr gene. According to the genome sequence of Escherichia coli BL21(DE3) published on NCBI, the glucose utilization gene cluster ptsHIcrr sequence was found, the cutting site N20 was selected on the crr gene, and the upstream homology arm and downstream homology arm of ptsHIcrr knockout were amplified by PCR Arm (homologous arm includes the upstream and downstream of the entire ptsHIcrr gene cluster, after homologous recombination, the ptsHIcrr gene cluster can be knocked out), the primers are as follows:

[0146] SA-18: GTGCCGTCTACTGGCGCGACATTGTATTTCCCCAACTTATAGG

[0147] SA-21: GAGATATGGGAAGATACCGACG

[0148] SA-19::CCTATAAGTTGGGGAAATACAATGTCGCGCCAGTAGACGGCAC

[0149] SA-22: CCAGCAGCATGAGAGCGATG

[0150] Primer annealing yields the cleavage site N20-sequence: ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a recombinant strain. The recombinant strains aroK, aroL and phosphoenolpyruvic acid-glucose phosphotransferase system operon (ptsHIcrr) gene are down-regulated, and aroB, aroD,aroE, aroF, tktA, ppsA genes are up-regulated. Among them, ptsHIcrr includes ptsH gene, ptsI gene and crr gene. The recombinant strain according to an embodiment of the invention is an industrial recombinant strain with high yield of shikimic acid.

Description

technical field [0001] The present invention relates to the field of bioengineering, specifically, the present invention relates to recombinant bacterial strains and applications thereof, more specifically, the present invention relates to recombinant bacterial strains, methods for constructing recombinant bacterial strains and methods for obtaining shikimic acid. Background technique [0002] Shikimic acid (3,4,5-3 hydroxy-1-cyclohexene-1-carboxylic acid), English name: shikimic acid (SA), is the key intermediate of the synthetic antiviral drug oseltamivir (Kewei) body. Shikimic acid is a white needle-like crystal, easily soluble in water, insoluble in some organic solvents such as petroleum ether, with a bitter smell and a melting point of 185-187°C. Shikimic acid is a key intermediate in the biosynthetic pathway of aromatic amino acids in organisms, and it is also an important precursor for the synthesis of indole derivatives, alkaloids, and chiral drugs (such as antivir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70C12P7/42C12R1/19
CPCC12N15/52C12N9/1205C12N9/88C12N9/0006C12N9/1085C12N9/1022C12N9/1294C12N9/1223C12Y207/01071C12Y402/03004C12Y101/01025C12Y402/0101C12Y205/01054C12N15/70C12P7/42C12Y202/01001C12Y207/09002C12Y207/03009C12Y207/01069
Inventor 刘翠翠姚红涛徐宇骋毛兴艳温素萍王鑫鑫谢文平李峰
Owner HEC PHARM
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap