TRV2 viral vector and application thereof in mutant gene library

A virus vector, TRV2-GT2 technology, applied in the field of plant protein and plant herbicide resistance, can solve the problems of time-consuming, laborious, limited scope of application, and low mutation efficiency

Active Publication Date: 2020-06-26
JIANGSU UNIV OF SCI & TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Traditional methods for obtaining mutant libraries, such as EMS mutagenesis, radiation mutagenesis, etc., have great uncertainty in the mutation sites on the genome, and the mutation efficiency is not high, and there are too few beneficial mutations, making mutant screening inefficient 1. Efficient cloning of functional genes is difficult, and it is impossible to realize directed mutagenesis breeding in the true sense; modern methods, such as genetic transformation of sgRNA libraries, require a large amount of genetic transformation work to obtain a large number of mutants, which is time-consuming and labor-intensive, and applicable The scope is very limited, and it can only be carried out in species that have established a complete genetic transformation system, such as rice, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • TRV2 viral vector and application thereof in mutant gene library
  • TRV2 viral vector and application thereof in mutant gene library
  • TRV2 viral vector and application thereof in mutant gene library

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0027] The preparation method of the transgenic tomato plant of the present invention preferably comprises the following steps: (1) amplifying the tomato herbicide-resistant gene ALS1, and utilizing point mutation to mutate the coding sequence CCA of the 186th amino acid Pro of its encoded protein into CT , get ALS1 CCA→CT ;

[0028] (2) the ALS1 CCA→CT Co-constructed with the Cas9 gene in the binary vector pCAMBIA1300;

[0029] (3) Transform the binary vector pCAMBIA1300 into tomato to overexpress Cas9 and ALS1 simultaneously CCA→CT transgenic tomato plants.

[0030] In the present invention, the nucleotide sequence encoding the tomato herbicide resistance protein ALS1 is preferably Solyc03g044330. And the point mutation in step (1) is modifying one base and deleting one base A at the same time, and the deleted base A is located at the fourth base in front of a PAM site.

[0031] The expression of Cas9 in the binary vector pCAMBIA1300 described in step (2) of the present...

Embodiment 1

[0039] Using tomato leaf cDNA as a template, the entire coding region of the tomato herbicide resistance gene ALS1 (Solyc03g044330) was amplified with primers ALS1-F (SEQ ID NO.1, ATGGCGGCTGCTGCCTCACC) and ALS1-R (SEQ ID NO.2, TCAATAGGAACATCTCCCATCG). Long sequence, this fragment was constructed in the pMD19-T intermediate vector (Takara company, product number D102A), and the vector pMD19-T-ALS1 was obtained WT ; Design a pair of primers ALS1-Fm (SEQ ID NO.3, TGCTAGGAGGATGATTGGTACTG) and ALS1-Rm (SEQ ID NO.4, CTAGCACTTGACCTGTAATAGCAAC) to introduce a base point mutation, with plasmid pMD19-T-ALS1 WT PCR amplification was performed as the template to obtain circularized DNA products. After the template plasmid was digested with DpnI enzyme, it was transformed into Escherichia coli, and the carrier pMD19-T-ALS1 with ALS1 point mutation was verified by Sanger sequencing. CCA→CT , thereby mutating the coding sequence CCA of the 186th amino acid Pro that controls the function of t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a TRV2 viral vector and application thereof in a mutant gene library, and relates to the field of plant protein ad plant herbicide resistance. The mutant gene library is constructed by using the TRV2 viral vector, and meanwhile, the efficiency of a mutant is higher in combination with two efficient manners including herbicide screening and virus infection. The mutant libraryhas higher flexibility and target, and mutation sites of the mutant are easier to identify. Mutant plants are screened by using the characteristic that ALS mutant protein is easy to screen by a herbicide, the herbicide is spayed on harvested seeds after germination acceleration and sowing, seedlings with gene mutation in a CCA-CT form have herbicide resistance and can survive, and target genes ofa library gRNA of the seedlings are also mutated at the same probability; herbicide-resistant seeds of the herbicide are harvested and subjected to selfing for genotype separation, and a large quantity of tomato homozygous mutants can be obtained.

Description

technical field [0001] The invention belongs to the fields of plant protein and plant herbicide resistance, and in particular relates to a TRV2 virus vector and its application in a mutant gene library. Background technique [0002] Traditional methods for obtaining mutant libraries, such as EMS mutagenesis, radiation mutagenesis, etc., have great uncertainty in the mutation sites on the genome, and the mutation efficiency is not high, and there are too few beneficial mutations, making mutant screening inefficient 1. Efficient cloning of functional genes is difficult, and it is impossible to realize directed mutagenesis breeding in the true sense; modern methods, such as genetic transformation of sgRNA libraries, require a large amount of genetic transformation work to obtain a large number of mutants, which is time-consuming and labor-intensive, and applicable The scope is very limited, and it can only be carried out in species that have established a complete genetic trans...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82C12N15/54C40B50/06A01H5/00A01H6/82
CPCC12N15/8203C12N15/8274C12N9/1022C40B50/06C12Y202/01006
Inventor刘超超王琼
OwnerJIANGSU UNIV OF SCI & TECH