Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cellulase gene gk2691 for encoding cellulase family GH30, and application thereof

A technology of gk2691 and GK2691, which is applied to the cellulase gene gk2691 encoding the cellulase family GH30 and its application fields, can solve the problems of low activity and low glycosidase content, and achieve simple material selection, effective utilization, and improved degradation efficiency Effect

Inactive Publication Date: 2020-07-10
GUANGXI UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most glycosidases in the cellulase system have low content and low activity, which become the bottleneck of cellulose enzymatic hydrolysis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cellulase gene gk2691 for encoding cellulase family GH30, and application thereof
  • Cellulase gene gk2691 for encoding cellulase family GH30, and application thereof
  • Cellulase gene gk2691 for encoding cellulase family GH30, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Cellulase gene gk2691 the acquisition of

[0024] (1) Weigh 25g of living coral samples, place them in a 50mL sterile centrifuge tube, add 20mL of sterile seawater, and vortex for 5-10min to completely disperse the coral tissue in the seawater; then dilute the shaken seawater 100 times Afterwards, 2216E plates were coated and cultured at room temperature for 24 hours to grow single colonies;

[0025] (2) Screen a single colony on the aescin plate, and the colony that makes the medium turn black is the functional colony; select the functional colony to purify on the 2216E plate, and transfer the functional colony to the MA medium after purification Continue to purify, and finally use a DNA kit to extract the DNA of the functional bacteria, and perform high-throughput sequencing to obtain the cellulase gene gk2691 ;

[0026] Such as figure 1 Shown is the function screening diagram of the aescin plate. Single colonies were screened out from a single strain ...

Embodiment 2

[0027] Example 2: Cellulase gene gk2691 cloning and expression.

[0028] The genes obtained through high-throughput sequencing were compared by NCBI to obtain the cellulase amino acid sequence (SEQID NO.2). If the amino acid sequence was correct, it was the target gene, and then primers were designed for it.

[0029] with upstream primer gk2691 F: GGCGGAATTATGAAAATGACCTCTCTCATGGCGTTATC, downstream primer gk2691 R: GCCGAAGCTTAGGGTGGCTAATTACAACTGTCTGTAACG, using high-throughput sequencing gene as template PCR amplification of cellulase gene gk2691 , followed by restriction endonuclease EcoR The amplified product was digested with Ⅰ and hind enzymes, ligated with the pET-22b expression vector digested with the same endonuclease, and then the ligated product was transformed into Escherichia coli DH5α, and spread to LB containing 50 μg / mL kanamycin Positive clones were screened on the culture medium plate, and the plasmid DNA was further extracted, and the recombinant plasmid ...

Embodiment 3

[0054] Example 3: Preparation of cellulase GK2691.

[0055] After 12 hours of incubation, the induced cells were collected at 8000 r, washed three times with PBS buffer, and finally 15-20 mL of PBS buffer was added to mix the cells, and the cells were broken with an ultrasonic cell breaker in an ice bath (power: 23%, working time: 20min). Then centrifuge at 4°C and 8000r for 15min, collect the supernatant, and obtain the crude enzyme solution. Finally, the substrate was used to detect the enzyme activity of the crude enzyme. The crude enzyme liquid was purified by a nickel chloride purification column to obtain pure enzyme, which was then desalted in a currency desalting column to obtain the final product cellulase GK2691. Finally, polyacrylamide electrophoresis was used to verify the result. See image 3 .

[0056] The analysis of the effect of cellulase GK2691 on pathogenic bacteria comprises the following steps:

[0057] Collect the v545 pathogenic bacteria cultured to ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel cellulase gene gk2691 for encoding a cellulase family GH30. The gene is cloned from a symbiotic microorganism meta-gene in corals, and has a nucleotide sequence shown bya sequence table SEQ ID NO.1. The invention also provides an amino acid sequence of the cellulase gene gk2691 for encoding the cellulase family GH30, wherein the sequence is shown by SEQ ID NO.2. Inaddition, the invention also provides an expression vector containing the gene as well as a host cell transformed by the expression vector. Cellulase encoded with the cellulase gene gk2691 has wide usages in degradation of cellulose.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a cellulase gene encoding cellulase family GH30 gk2691 and its application. Background technique [0002] Cellulose is the most renewable energy source in the world. The biomass generated by plant photosynthesis is as high as 150 billion tons every year. However, due to the complex structure of cellulose, a large part cannot be directly used, so it needs cellulase degradation. Cellulose is a macromolecule composed of glucose units linked by β-1,4-glycosidic bonds. Cellulase is a general term for a class of enzymes that can degrade cellulose and finally convert it into glucose, including endo-1,4-β-D-glucanase (EC 3.2.1.4, EG for short); Cellulase (exo-1,4-β-D-glucanase, EC 3.2.1.91, referred to as CBH); β-glucosidase (β-D-glucosidase, EC 3.2.1.21, referred to as BG). The role of cellulase is the last step in the enzymatic hydrolysis of cellulose. By acting on cellobiose, it is hyd...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/56C12N9/42C12P19/14
CPCC12N9/2437C12P19/14C12Y302/01021
Inventor 苏宏飞肖振伦余克服王英辉杨镇业黄雄良张琦
Owner GUANGXI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com