Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving resistance of formic acid and acetic acid in cellulose hydrolysate by utilizing formic acid dehydrogenase

A cellulose hydrolyzate and formate dehydrogenase technology, which is applied in the field of bioengineering to achieve the effects of cost saving, improving resistance and improving formate dehydrogenase activity

Inactive Publication Date: 2020-07-10
DALIAN UNIV OF TECH
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Formate dehydrogenase produces carbon dioxide by catalyzing the oxidation of formic acid, and produces reducing NADH and ATP. It is known and widely used in the generation of putrescine (patent application number 201780017515.4), the reduction of coenzymes (patent application number 201711230338.6 ) and other reactions, but there is no report on improving the stress ability of acetic acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving resistance of formic acid and acetic acid in cellulose hydrolysate by utilizing formic acid dehydrogenase
  • Method for improving resistance of formic acid and acetic acid in cellulose hydrolysate by utilizing formic acid dehydrogenase
  • Method for improving resistance of formic acid and acetic acid in cellulose hydrolysate by utilizing formic acid dehydrogenase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1: Construction of bacterial strain S.cerevisiae-FDH

[0024] 1) Using the genome of Saccharomyces cerevisiae model strain S288C as a template for PCR amplification to obtain the Fdh gene fragment, the nucleotide sequences of the upstream and downstream primers are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively:

[0025] Upstream primer: attg cggccgct atgtcgaagggaaaggttttg (SEQ ID NO. 1)

[0026] Downstream primer: acgcgc gtcgac ttatttcttctgtccataag (SEQ ID NO.2)

[0027] The kit used for PCR amplification is HS DNA Polymerase (Code No.: R010A) was purchased from Treasure Bioengineering (Dalian) Co., Ltd., and the PCR reaction was carried out according to the instructions of the kit.

[0028] The PCR amplification conditions are: 98°C pre-denaturation for 5 minutes; 98°C for 15s, 55°C for 15s, 72°C for 60s, 30 cycles; 72°C for 7min;

[0029] 2) The obtained Fdh gene fragment was double-digested with restriction endonucleases Not I and Sal I, and th...

Embodiment 2

[0034] Embodiment 2: adopt two-step method to ferment cellulose raw material to produce xylitol and ethanol, the investigation of the growth situation on the plate containing formic acid and acetic acid

[0035] 1) Preparation of activation medium: activation medium: YNB 6.7g / L, glucose 10g / L, amino acid supplement solution without Trp.

[0036] 2) Activation of the strains: the strain S. cerevisiae-FDH prepared in Example 1 and the original strain S. cerevisiae S288C stored in the refrigerator were inoculated into the activation medium, placed in a shaker at 30° C., and cultured at 150 rpm for 24 hours.

[0037] 3) Preparation of seed medium: seed medium: YNB 6.7g / L, glucose 20g / L, amino acid supplement solution without Trp.

[0038] 4) The activated bacteria in step 2) were transferred to the seed medium prepared in step 3), and placed in a shaker at 30° C., 150 rpm for 24 hours.

[0039] 5) Preparation of differential medium: differential medium: YNB 6.7g / L, glucose 20g / L,...

Embodiment 3

[0042] Example 3: Fermentation in liquid medium containing acetic acid

[0043] 1) Activation medium: YNB 6.7g / L, glucose 10g / L, amino acid supplement solution without Trp.

[0044] 2) The strain S.cerevisiae-FDH prepared in Example 1 and the original strain stored in the refrigerator were inoculated into the activation medium, placed in a shaker at 30° C., and cultured at 150 rpm for 24 hours.

[0045] 3) Preparation of seed medium: seed medium: YNB 6.7g / L, glucose 20g / L, amino acid supplement solution without Trp.

[0046] 4) Take the activated bacteria and transfer them to the seed medium prepared in step 3), place them in a shaker at 30° C., and cultivate them at 150 rpm for 24h-48h.

[0047] 5) Preparation of fermentation medium: fermentation medium: YNB 6.7g / L, glucose 40g / L, Trp-free amino acid supplement solution, acetic acid 4g / L.

[0048] 6) After the strains are activated and the seeds are expanded and cultivated, the cells are collected by centrifugation, and the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving resistance of formic acid and acetic acid in cellulose hydrolysate by utilizing formic acid dehydrogenase. The method improves the tolerance capability of a strain to acetic acid and formic acid in the cellulose hydrolysate by overexpressing the formic acid dehydrogenase. In the method provided by the invention, the formic acid dehydrogenase can be overexpressed in a cellulose ethanol production strain, the resistance of the strain to formic acid and acetic acid in the cellulose hydrolysate is improved, the method is simple and feasible, the material detoxification cost is reduced, and the industrial production of the cellulose ethanol is facilitated.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to a method for improving the resistance of formic acid and acetic acid in cellulose hydrolyzate by using formate dehydrogenase. Methods for formic and acetic acid tolerance. Background technique [0002] Cellulosic feedstocks are widely available and inexpensive, and efficient conversion of cellulosic feedstocks is also beneficial to rural economies and has been extensively studied for the production of biofuels and biobased chemicals. Lignocellulosic raw materials need to be pretreated to obtain sugars that can be directly used by microorganisms, but after pretreatment, various inhibitors will be produced that are toxic to cell growth and metabolism and affect subsequent fermentation. Inhibitors mainly include: weak acids (formic acid and acetic acid, etc.), furans (furfural and 5-hydroxymethylfurfural, etc.), phenolic compounds (vanillin and 4-salicylic acid, e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/78C12N15/81C12N9/04C12P7/06C12P7/18
CPCC12N15/70C12N15/78C12N15/81C12N15/815C12N9/0006C12Y101/05006C12P7/06C12P7/18Y02E50/10
Inventor 袁文杰杜聪李益民
Owner DALIAN UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com