Recombinant fibronectin mutant and application thereof

A fibronectin and mutant technology, applied in the field of biology, can solve the problems of protein misfolding and aggregation, slowness, and inability to obtain soluble protein, and achieve the effect of improving cell adhesion activity, promoting cell proliferation activity, and convenient purification.

Active Publication Date: 2020-07-28
GUANGDONG MARUBI BIOLOGICAL TECH CO LTD
View PDF6 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the latest research shows that although different DNA can be translated into the same amino acid, the speed of protein production (translation speed) is not constant, and it will be slower in some segments. This phenomenon is called translational pause (translational pause or translational attenuation) The translation pause site is highly related to protein folding. If the translation pause site is incorrect, the place that should be slow is fast, or the place that should be fast is slow, it will lead to protein misfolding and aggregation, and functional soluble protein cannot be obtained. protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant fibronectin mutant and application thereof
  • Recombinant fibronectin mutant and application thereof
  • Recombinant fibronectin mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1 recombinant fibronectin carrier construction

[0037] We selected the functional domains of fibronectin to promote cell proliferation and adhesion through biological macromolecule simulation, and designed new fibronectin mutants. The nucleotide sequences of the fibronectin mutants were optimized according to the codon bias of E. coli and by translation pause theory. And entrusted Suzhou Synbio Biotechnology Co., Ltd. to synthesize the fibronectin mutant DNA from the whole gene.

[0038] The nucleotide sequence of unoptimized recombinant fibronectin is as follows:

[0039] ACGGGCATCGACTTCAGCGATATCACCGCGAACAGCTTCACCGTTCACTGGATCGCGCCACGTGCGACGATCACCGGCTATCGCATCCGCCATCACCCGGAACACTTTAGCGGTCGTCCACGCGAAGATCGCGTTCCGCATAGCCGCAATAGCATCACGCTGACCAATCTGACCCCGGGCACCGAATATGTTGTGAGCATCGTGGCGCTGAACGGCCGCGAAGAAAGCCCACTGCTGATTGGCCAGCAGAGCACCGTGAGTGATGGTGGCGGTGGCAGCAATATTGATCGCCCGAAAGGTCTGGCCTTCACGGATGTGGACGTGGACAGCATCAAAATCGCGTGGGAAAGCCCACAAGGCCAAGTTAGCCGCTACCGCGTGACCTATAGCA...

Embodiment 2

[0046] Expression and purification of embodiment 2 recombinant fibronectin mutants

[0047] (1) Preparation of fibronectin expression strain:

[0048] The preparation process of the fibronectin expression bacterial strain is:

[0049] ① Preparation of Escherichia coli BL21(DE3) competent cells: For the preparation process, please refer to the third edition of "Molecular Cloning Experiment Guide"; [US] J. Sambrook, translated by Huang Peitang.

[0050] ②Transform the expression vector pET-28a-Fibronectin into Escherichia coli BL21(DE3) competent cells: see the third edition of "Molecular Cloning Experiment Guide" for details on the transformation process; [US] J. Sambrook, translated by Huang Peitang.

[0051] (2) Induced expression and solubility analysis of fibronectin mutants

[0052] The specific operation process is as follows:

[0053] The expression strain pET-28a-Fibronectin obtained in step (1) was inoculated into 10 mL of LB medium containing 50 μg / mL kanamycin con...

Embodiment 3

[0065] Example 3 Determination of the Proliferative Activity of Recombinant Fibronectin Mutants

[0066] The specific measurement process is:

[0067] (1) BALB / c 3T3 cells were seeded in 96-well cell culture plates (5000 cells / well), 37°C, 5% CO 2 Cultivate in a cell incubator for 24 hours;

[0068] (2) Replace with DMEM serum-free medium and continue culturing for 12 hours;

[0069] (3) Add recombinant fibronectin mutants (soluble expression purification fraction, inclusion body expression purification fraction) and PBS (negative control group) respectively, and continue culturing for 48-72 hours;

[0070] (4) Add 10 μL CCK-8 reagent to each well, 37°C, 5% CO 2 Take it out after incubating in the cell incubator for 2 hours;

[0071] (5) Read the absorbance values ​​of the 96-well plate at 450nm and 630nm with a microplate reader, take 630nm as the reference wavelength, measure the absorbance at 450nm, and record the measurement results.

[0072] Relative cell proliferati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biology, and particularly relates to a nucleotide sequence of a recombinant fibronectin mutant and application of the recombinant fibronectin mutant. According tothe recombinant fibronectin mutant provided by the invention, a structural domain for promoting cell adhesion and cell proliferation on fibronectin is selected, the nucleotide sequence for coding therecombinant fibronectin mutant is designed by utilizing a translation pause theory, and under the condition of unchanging an amino acid sequence of the recombinant fibronectin, the recombinant fibronectin is obtained by replacing a codon with a higher translation speed in the last 20 codons of the recombinant fibronectin with a codon with a lower translation speed. The recombinant fibronectin mutant provided by the invention is simple in purification process and can promote cell proliferation activity and adhesion activity.

Description

technical field [0001] The invention belongs to the field of biology, and in particular relates to a recombinant fibronectin mutant and application thereof. Background technique [0002] Fibronectin (FN) is a macromolecular glycoprotein in the extracellular matrix, which widely exists in plasma, various cell surfaces and cell matrices, and is one of the important adhesion molecules in the extracellular matrix. Zonulin binds to integrin receptors on the cell membrane, plays an extremely important function in the interaction between cells and between cells and the matrix, and plays an important role in regulating cell adhesion, migration, proliferation, etc. Plays an important role in wound repair and healing (Klein, R.M., et al. (2003). "Stimulation of extracellular matrix remodeling by the first type III repeat in fibronectin." J Cell Sci 116(Pt 22):4663-4674.) . [0003] Fibronectin is a key protein in wound repair. Research has found that wound repair is completed by th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/78C12N15/12C12N15/70C12Q1/02
CPCC07K14/78C12N15/70G01N33/5008C12N2800/22
Inventor郭朝万孙云起陈伟熊盛聂艳峰刘忠
OwnerGUANGDONG MARUBI BIOLOGICAL TECH CO LTD