Unlock instant, AI-driven research and patent intelligence for your innovation.

Anti-African swine fever virus fusion protein as well as preparation method and application thereof

A fusion protein and anti-virus technology, applied in the field of genetic engineering, can solve the problems that antibiotic veterinary drugs cannot be cured and controlled, cannot enter the blood circulation system, and lose active functions. It takes a long time to achieve drug efficacy, good drug stability, and Effect with low side effects

Active Publication Date: 2020-09-04
江苏芝海生物科技有限公司
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The outbreak of viral epidemics, similar to African swine fever, blue ear disease, etc., is something that antibiotics and veterinary drugs cannot cure and control.
[0005] However, protein drugs have application problems such as stimulating the body's immunogenicity, being easily metabolized by proteases in the circulatory system, difficulty in targeted administration, unstable properties, easy high-temperature denaturation, and high price. After passing through the oral digestive system, it is easily digested and degraded by digestive tract enzymes such as pepsin and trypsin, losing its active function and unable to enter the blood circulation system to exert its medicinal effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-African swine fever virus fusion protein as well as preparation method and application thereof
  • Anti-African swine fever virus fusion protein as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Amplification of DN-α fragments:

[0040] (1) Using the synthetic IFN-α whole gene sequence (shown in SEQ ID No.9) as a template, use the following primers to perform PCR amplification to obtain the IFN-α fragment:

[0041] TGCGATCTGCCGCAGACCCATAGCCTGGCGCATACCCGCGCGCTGCGCCTGCTGGCGCAGATGCGCCGCATTAGCCCGTTTAGCTGCCTGGATCATCGCCGCGATTTTGGCTTTCCGCAGGAAGCGCTGGGCGGCAACCAGGTGCAGAAAGCGCAGGCGATGGCGCTGGTGCATGAAATGCTGCAGCAGACCTTTCAGCTGTTTAGCACCGAAGGCAGCGCGGCGGCGTGGGATGAAAGCCTGCTGCATCAGTTTTGCACCGGCCTGGATCAGCAGCTGCGCGATCTGGAAGCGTGCGTGATGCAGGAAGCGGGCCTGGAAGGCACCCCGCTGCTGGAAGAAGATAGCATTCTGGCGGTGCGCAAATATTTTCATCGCCTGACCCTGTATCTGCAGGAAAAAAGCTATAGCCCGTGCGCGTGGGAAATTGTGCGCGCGGAAGTGATGCGCGCGTTTAGCAGCAGCCGCAACCTG(SEQ ID No.9)

[0042] PCR amplification system: PFU ultra II Fusion buffer 2μl, dNTP (10mM each) 0.4μl, FWprimer (20μM) 0.4μl, REV primer (20μM) 0.4μl, Template 0.1μl, Sterile miliQ water16.3μl, pFU ultra IIfusion enzyme 0.4 μl.

[0043] The PCR reaction procedure is as follows:

[...

Embodiment 3

[0101] For verifying beneficial effect of the present invention, carry out following test, test method and result are as follows:

[0102] (1) Experimental animals

[0103] A farm has a group of pigs, 1-5 parity-age sows, weighing 50-200kg, some of them have symptoms such as high fever, dyspnea, cough, runny nose, skin cyanosis, anorexia, depression, and sow abortion. Various antibiotics are used And antipyretic peony has no therapeutic effect, and a large number of deaths in a short period of time. Symptoms and autopsy confirmed infection with African swine fever.

[0104] (2) Clinical trials

[0105] Mix the prepared yeast cells containing fusion proteins DN-α and DN-γ at a mass ratio of 1:1; then add 100g of dry yeast and 100g of Bacillus for every 1g of the mixture, and mix them evenly, and randomly select them on the diseased pig farm 30 sick pigs were used as the administration group, and the pigs were fed with 1 g per 100 kg of pig body weight for 10 consecutive days...

Embodiment 4

[0112] Drugs for the prevention and / or treatment of African swine fever disease

[0113] The prepared yeast cells containing the fusion proteins DN-α and DN-γ were mixed at a mass ratio of 1:1; then, according to every 1g of the mixture, 100g of dry yeast was added, and 100g of bacillus was mixed evenly to obtain the drug. The daily feeding amount of a pig is 1g, and 10 consecutive days of feeding is a course of treatment.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an anti-African swine fever virus fusion protein as well as a preparation method and application thereof, and belongs to the technical field of gene engineering, the anti-African swine fever virus fusion protein comprises a structural protective peptide DNBLK1 and an active protein, and the structural protective peptide DNBLK1 and the active protein are connected through a connecting peptide; wherein the active protein is porcine autoimmune regulator protein INF-gamma or antiviral polypeptide IFN-alpha; wherein the porcine autoimmune modulator protein can activate an immune system in a pig body at the first time of virus infection and activate an antiviral reaction; the antiviral polypeptide directly acts on the virus to inhibit the replication of the virus in vivo and destroy the virus structure; and the two components have a synergistic effect to realize prevention and treatment of African swine fever. The drug for preventing and / or treating African swine feverprovided by the invention has the advantages of broad-spectrum disease resistance, small residue, no pollution, no drug resistance, no drug residue and the like, is used in the early stage of virus infection, and has a remarkable prevention and control effect.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a fusion protein against African swine fever virus and its preparation method and application. Background technique [0002] African swine fever virus (ASFV) belongs to the African swine fever virus family, ASFV genus, double-stranded DNA virus. It is currently the only DNA arbovirus. No virus serologically related to ASFV has been found so far. ASFV is a very complex virus. There are 28 structural proteins that have been identified. More than half of the more than 200 encoded proteins have unknown functions. In infected macrophages, more than 100 proteins have been identified. Virus-induced proteins, at least 50 of which can react with serum from infected or recovered pigs, and 40 of which can bind to virions. There are at least 8 serotypes of ASFV, the antigens are easily mutated, and typical neutralizing antibodies are not produced. These are obstacl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/81A61K38/21A61K47/64A61K47/65A61P31/20A23K20/147A23K10/18A23K50/30A61K36/064A61K35/742C12R1/84
CPCC07K14/56C07K14/57C07K14/00C12N15/815A61K38/212A61K38/217A61K47/64A61K47/65A61P31/20A61K36/064A61K35/742A23K20/147A23K10/18A23K50/30C07K2319/00A61K2300/00
Inventor 王学庆王楠王嘉轩
Owner 江苏芝海生物科技有限公司