Retinochrome degeneration macaque model construction method based on in-vivo gene knockout

A retinal pigment and gene technology, applied in the field of molecular biology, can solve the problems of low number of offspring, limitations of transgenic macaque RP models, obstacles to RP disease research and treatment development, etc.

Inactive Publication Date: 2020-10-30
UNIV OF SCI & TECH OF CHINA
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Even so, due to the extremely long reproductive cycle and the very small number of offspring, there are still great limitations in the construction of a transgenic macaque RP model. It is even more impractical to widely use this kind of macaque genetic RP model, which seriously hinders the research and treatment of RP diseases. development of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Retinochrome degeneration macaque model construction method based on in-vivo gene knockout
  • Retinochrome degeneration macaque model construction method based on in-vivo gene knockout
  • Retinochrome degeneration macaque model construction method based on in-vivo gene knockout

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1. In vivo gene transduction of macaque retinal photoreceptor cells

[0055] In this example, taking the RHO gene as an example, we designed three sgRNAs targeting the rhesus monkey RHO gene, such as figure 1 As shown, the specific sequences of sgRNA1-3 are respectively SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5. Subsequently, three sgRNAs were constructed in figure 2 After the U6 promoter in the plasmid-AAV vector, the subsequent packaged AAV can express the Cas9 gene editing enzyme and sgRNAs at the same time. This vector is designed to be transformed from Zhangfeng pX602 plasmid. Specifically: the TBG promoter in the Addgene plasmid #61593 (pX602) was digested with Xba1 / Age1 and replaced with the hSyn promoter. The transformed plasmid is as follows figure 2 As shown in plasmid one, its full vector sequence is SEQ ID NO:1. Taking sgRNA1 as an example, two short DNA sequences CACCGCGGGCGTGGTGCGCAGCCCCT (SEQ ID NO: 8) and AAACAGGGGCTGCGCACCACGCCCGC (SEQ ID ...

Embodiment 2

[0063] Example 2. Rhesus monkey retinal photoreceptor cell RHO knockout detection

[0064] In Example 2, as in Example 1, we packaged the AAV virus and completed the subretinal injection of macaques. At the same time, we injected AAV-GFP and SaCas9 into the left eye of macaques, that is, this group of viruses does not contain sgRNA, so The group that cannot target RHO and knock it out is called the control virus group; while we injected AAV-GFP and SaCas9 / sgRNAs into the right eye, this group of viruses can effectively target RHO and knock it out, which we call the experimental virus group.

[0065] Rhesus monkeys were sacrificed and sampled three months after injection. After surgery, we obtained retinal samples from rhesus monkeys. The whole retinal genome was extracted with a genome extraction kit (Qiagen), and the primers CATTCTTGGGTGGGAGCAGA (SEQ ID NO: 14) and CAAGGTAGCGTTCAGAGCCA (SEQ ID NO: :15) Perform PCR (NEB, Q5) to specifically amplify the first exon of RHO, and p...

Embodiment 3

[0066] Example 3. Photoreceptor cell degeneration (injection for 4 months)

[0067] Same as in Example 2, we sacrificed samples from rhesus monkeys injected with virus for 4 months, and carried out frozen sections (14 microns) of rhesus monkey retinas after virus injection, immunohistochemical staining with antibody RHO (sigma), and using Laser confocal microscope for microscopic observation. Immunohistochemistry is a common biological experiment method, which will not be repeated here.

[0068] Such as Figure 5 As shown, GFP is the green fluorescent protein expressed by AAV-GFP, and it can be seen that it is distributed in the photoreceptor cells in the outer nuclear layer, that is, our method achieves efficient in vivo gene transduction of rhesus monkey retina photoreceptor cells. At the same time, in the RHO immunohistochemical display, it can be seen that the RHO immunofluorescence signal is significantly reduced, and the structure of the outer and inner segments of the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

According to the invention, a CRISPR gene editing system and an AAV transduction system are utilized to directly knock out an RHO gene from adult macaque retinal photoreceptor cells so as to simulateretinal degeneration degeneration caused by hereditary RHO mutation, and a macaque retinal pigment degeneration (RP) animal model is constructed within 3-6 months. The model can promote research and treatment of human RP diseases.

Description

technical field [0001] The present invention relates to the field of molecular biology. Specifically, the present invention relates to gene knockout by gene editing technology to realize animal disease modeling. Background technique [0002] Since Prof. Zhang Feng from MIT researched and developed CRISPR / Cas9 gene editing technology (PMID: 24157548) in 2013, this gene editing technology has been widely used in mammalian genetic modification, including genetic disease animal modeling. Retinitis pigmentosa (RP) is one of the most widespread hereditary blinding diseases. It has many pathogenic genes, and single-gene mutations also account for a large proportion of the disease. For example, mutations in RHO, USH2A, RP1, PRPF31 and other genes can cause Overt or recessive RP onset (PMID: 23701314). Animals currently used in research on RP are focused on rodent disease models, such as the P23H gene knock-in mouse model constructed by Krzysztof Palczewski (PMID: 21224384). Howev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/864C12N15/90C12N15/12A01K67/027
CPCA01K67/0276A01K2217/075A01K2227/106A01K2267/03C07K14/47C12N15/86C12N15/907C12N2750/14143C12N2800/107
Inventor薛天李守振章梅
OwnerUNIV OF SCI & TECH OF CHINA