Lactobacillus rhamnosus LRa05 for antagonizing shigella, screening method and application of lactobacillus rhamnosus LRa05

A technology of Lactobacillus rhamnosus and Shigella, applied in the field of microorganisms, can solve the problems of different physiological and biochemical properties and bacteriostatic properties, and achieve the effects of excellent safety, good acid resistance and good antagonism.

Active Publication Date: 2021-01-12
JIANGSU WECARE BIOTECHNOLOGY CO LTD
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Lactic acid bacteria are a general term for bacteria that can ferment carbohydrates to produce a large amount of lactic acid. They are widely found in naturally fermented dairy products, fermented traditional foods and the human intestine. Lactic acid bacteria can regulate the balance of intestinal flora, control endotoxins, and inhibit intestinal pathogenic The growth and reproduction of pathogens can have beneficial effects on the nutritional status, phys...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lactobacillus rhamnosus LRa05 for antagonizing shigella, screening method and application of lactobacillus rhamnosus LRa05
  • Lactobacillus rhamnosus LRa05 for antagonizing shigella, screening method and application of lactobacillus rhamnosus LRa05
  • Lactobacillus rhamnosus LRa05 for antagonizing shigella, screening method and application of lactobacillus rhamnosus LRa05

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Screening of Lactobacillus rhamnosus LRa05 strain

[0033] 1. Sample collection

[0034] Collect traditional fermented food (this example selects local traditional handmade yogurt collected in Guoluo Tibetan Autonomous Prefecture, Qinghai Province) for pretreatment to obtain sample treatment solution, take 25mL of sample treatment solution in 225mL sterilized normal saline, mix well, Obtain bacterial suspension;

[0035] 2. Isolation of strains

[0036] The bacterial suspension was diluted 10-fold to 10 -3 、10 -4 、10 -5 、10 -6Four concentrations were applied to the mixture containing cycloheximide (the concentration of cycloheximide is 10-50ug / g, Thermo Fisher Scientific (OXID) company) and vancomycin (vancomycin 20-50ug / g , Zhejiang Hisun Pharmaceutical Co., Ltd.) on the MRS agar plate medium, 10 plates for each gradient concentration, the surface of the MRS agar plate medium is poured with calcium carbonate, cultured anaerobically at 30-37 ° C for 48-72h, observ...

Embodiment 2

[0050] Identification of Lactobacillus rhamnosus LRa05

[0051] The Lactobacillus rhamnosus LRa05 screened in Example 1 was identified for its 16S rRNA gene sequence and pheS gene sequence, and compared with the model strain by Blast, the identification results showed that Lactobacillus rhamnosus LRa05 belongs to Lactobacillus rhamnosus . The 16S rRNA gene sequence and the pheS gene sequence are as follows:

[0052] The 16S rRNA gene sequence of Lactobacillus rhamnosus LRa05 is:

[0053] TATACATGCAGTCGAACGAGTTCTGATTATTGAAAGGTGCTTGCATCTT GATTTAATTTTGAACGAGTGGCGGACGGGTGAGTAACACGTGGGTAACCT GCCCTTAAGTGGGGGATAACATTTGGAAACAGATGCTAATACCGCATAAAT CCAAAAACCGCATGGTTCTTGGCTGAAAGATGGCGTAAGCTATCGCTTTTG GATGGACCCGCGGCGTATTAACTAGTTGGTGAGGTAACGGCTCACCAAGG CAATGATACGTAACCCAACTGAAAGGTTGATCGGCCACATTGGGACTGAA ACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATG GACGCAAGTCTGATGGAACAACGCCCCGTGAGTGAAGAAGGCTTTCGGGT CGTAAAACTCTGTTGTTGGAAAAAAATGGTCGGCAGAATAACTGTTGTCG GCGTGACGGTATCCAACCAGAAAGCCACGGCTAACTA...

Embodiment 3

[0057] Morphological characteristics of Lactobacillus rhamnosus LRa05

[0058] Lactobacillus rhamnosus LRa05 was subjected to microscopic examination after Gram staining, and the results were as follows: figure 1 As shown, it can be seen from the figure that Lactobacillus rhamnosus LRa05 has the following characteristics: the bacteria are rod-shaped, with round ends, 4.0-10.0 μm long, 0.4-1.0 μm wide, in pairs, chains, present in short chains.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to view more

Abstract

The invention discloses lactobacillus rhamnosus LRa05, and the lactobacillus rhamnosus is collected in China General Microbiological Culture Collection Center, and the collection number is CGMCC 1.12734; the antagonistic ability of the lactobacillus rhamnosus has a good antagonistic effect on shigella, and the antagonistic ability of the lactobacillus rhamnosus is superior to that of common lactobacillus and commercial strain lactobacillus rhamnosus LGG; moreover, the lactobacillus rhamnosus has the characteristics of good acid resistance and bile tolerance; Animal test and human body test results show that a health-care food prepared from the lactobacillus rhamnosus LRa05 can effectively relieve symptoms including abdominal pain, diarrhea, fever and the like caused by the shigella; and besides, the lactobacillus rhamnosus belongs to probiotics, has been already incorporated into safe strains which can be applied to a food list directory, is excellent in safety, and can replace traditional antibiotics for use.

Description

technical field [0001] The invention relates to the technical field of microbes, in particular to Lactobacillus rhamnosus LRa05 antagonizing Shigella, a screening method and application thereof. Background technique [0002] Shigella Castellani (Shigella Castellani) is a kind of Gram-negative short bacillus, which is the most common pathogen of human bacillary dysentery. It belongs to Enterobacteriaceae and is divided into four groups: Shigella dysenteriae, Shigella flexneri bacilli, Shigella baumannii, and Shigella sonnei. No spores, no capsule, no flagella, most with pili. Enteropathogenic bacteria in humans and primates, causing bacillary dysentery. Every year, 200 million people worldwide are infected with shigella, and millions of people need to be hospitalized every year, and a large number of fatal cases occur in developing countries. It can kill as many as half a million people each year. Shigella-induced dysentery is primarily due to disruption of the intestinal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/20A23L33/135A23L33/21A23L33/125C12R1/225
CPCC12N1/20A23L33/135A23L33/21A23L33/125C12R2001/225C12N1/205A23V2400/165A23V2400/175A23V2400/113A23V2400/169Y02A50/30
Inventor 方曙光严涛陈珂可朱建国冯胜鹏程文
Owner JIANGSU WECARE BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap