Lactobacillus rhamnosus LRa05 for antagonizing shigella, screening method and application of lactobacillus rhamnosus LRa05
A technology of Lactobacillus rhamnosus and Shigella, applied in the field of microorganisms, can solve the problems of different physiological and biochemical properties and bacteriostatic properties, and achieve the effects of excellent safety, good acid resistance and good antagonism.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Screening of Lactobacillus rhamnosus LRa05 strain
[0033] 1. Sample collection
[0034] Collect traditional fermented food (this example selects local traditional handmade yogurt collected in Guoluo Tibetan Autonomous Prefecture, Qinghai Province) for pretreatment to obtain sample treatment solution, take 25mL of sample treatment solution in 225mL sterilized normal saline, mix well, Obtain bacterial suspension;
[0035] 2. Isolation of strains
[0036] The bacterial suspension was diluted 10-fold to 10 -3 、10 -4 、10 -5 、10 -6Four concentrations were applied to the mixture containing cycloheximide (the concentration of cycloheximide is 10-50ug / g, Thermo Fisher Scientific (OXID) company) and vancomycin (vancomycin 20-50ug / g , Zhejiang Hisun Pharmaceutical Co., Ltd.) on the MRS agar plate medium, 10 plates for each gradient concentration, the surface of the MRS agar plate medium is poured with calcium carbonate, cultured anaerobically at 30-37 ° C for 48-72h, observ...
Embodiment 2
[0050] Identification of Lactobacillus rhamnosus LRa05
[0051] The Lactobacillus rhamnosus LRa05 screened in Example 1 was identified for its 16S rRNA gene sequence and pheS gene sequence, and compared with the model strain by Blast, the identification results showed that Lactobacillus rhamnosus LRa05 belongs to Lactobacillus rhamnosus . The 16S rRNA gene sequence and the pheS gene sequence are as follows:
[0052] The 16S rRNA gene sequence of Lactobacillus rhamnosus LRa05 is:
[0053] TATACATGCAGTCGAACGAGTTCTGATTATTGAAAGGTGCTTGCATCTT GATTTAATTTTGAACGAGTGGCGGACGGGTGAGTAACACGTGGGTAACCT GCCCTTAAGTGGGGGATAACATTTGGAAACAGATGCTAATACCGCATAAAT CCAAAAACCGCATGGTTCTTGGCTGAAAGATGGCGTAAGCTATCGCTTTTG GATGGACCCGCGGCGTATTAACTAGTTGGTGAGGTAACGGCTCACCAAGG CAATGATACGTAACCCAACTGAAAGGTTGATCGGCCACATTGGGACTGAA ACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATG GACGCAAGTCTGATGGAACAACGCCCCGTGAGTGAAGAAGGCTTTCGGGT CGTAAAACTCTGTTGTTGGAAAAAAATGGTCGGCAGAATAACTGTTGTCG GCGTGACGGTATCCAACCAGAAAGCCACGGCTAACTA...
Embodiment 3
[0057] Morphological characteristics of Lactobacillus rhamnosus LRa05
[0058] Lactobacillus rhamnosus LRa05 was subjected to microscopic examination after Gram staining, and the results were as follows: figure 1 As shown, it can be seen from the figure that Lactobacillus rhamnosus LRa05 has the following characteristics: the bacteria are rod-shaped, with round ends, 4.0-10.0 μm long, 0.4-1.0 μm wide, in pairs, chains, present in short chains.
PUM
Property | Measurement | Unit |
---|---|---|
Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com