Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Monoclonal antibody of actinobacillus pleuropneumoniae rApxIVAN and application thereof

A technology of pleuropneumonia and actinobacillus, applied in the field of clinical immunology, can solve problems such as poor sensitivity and achieve the effect of improving specificity

Active Publication Date: 2021-02-23
INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, Hao Chengwu expressed the ApxIV2 (1497bp-2873bp) fragment of APP and established a latex agglutination method, but the sensitivity is not good. The sensitivity for the same standard positive serum LAT is 1:32 times dilution, while the sensitivity of ELISA is 1: More than 80 (Hao Chengwu, 2010); Yang Yongneng synthesized two pairs of specific primers with amplifiable lengths of 442bp and 378bp respectively, and established a nested PCR detection method for APP; (, 2019); Huang Hongliang and Shi Qin prokaryotically expressed the apxIVA gene N 2445bp at the A-terminus of ApxlVA3 gene and 440bp at the A-terminus of the ApxlVA3 gene. An indirect ELISA method has been established, but the expression product exists in the form of inclusion bodies, which requires denaturation and renaturation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Monoclonal antibody of actinobacillus pleuropneumoniae rApxIVAN and application thereof
  • Monoclonal antibody of actinobacillus pleuropneumoniae rApxIVAN and application thereof
  • Monoclonal antibody of actinobacillus pleuropneumoniae rApxIVAN and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Obtaining the hybridoma cell line secreting Actinobacillus pleuropneumoniae toxin ApxIVAN monoclonal antibody:

[0026] (1) Transformation of the ApxIVAN antigen gene and protein expression and purification: The APP exotoxin apxIVAN gene was cloned, analyzed and subjected to point mutations, and a region with no signal peptide and rich epitopes was selected for recombinant expression in Escherichia coli. The recombinant plasmid pET20a-apxⅣAN of this sequence induces and expresses the target protein amount accounting for 32.6% of the total bacterial protein. The specific steps are as follows:

[0027] Amplification and transformation of the target gene: using the genomic DNA of Actinobacillus pleuropneumoniae serotype 1 strain as a template, two primers were designed for the apxⅣAN gene (GenBank accession number CP001091), and the upstream primer P1: ATATA CATATG CGCGCCTATATCTGGAATACC, NdeI restriction site; downstream primer P2: ATTG CTCGAG CCCTTCGAATTGTTTCGCATTAAC, ...

Embodiment 2

[0066] Application of a monoclonal antibody against Actinobacillus pleuropneumoniae rApxIVAN in the preparation of an indirect competition ELISA detection kit:

[0067] ① Selection of optimal antigen coating concentration and working concentration of enzyme-labeled monoclonal antibody

[0068]Antigen protein rApxIVAN (initial concentration 162.88 μg / mL) was diluted 6 gradients, coated with ELISA plate, overnight at 4°C; washed 3 times with PBST, blocked with 1% BSA for 2 hours; washed 3 times with PBST, added The 2-fold diluted standard negative serum and positive serum were reacted at 37°C for 1 hour; the plate was washed 3 times with PBST, and the HRP enzyme-labeled monoclonal antibody diluted 1:2000-1:25600 times was added, and the indirect competition ELISA square array test was performed, and the calculation Inhibition rate (Percentage inhibition, PI), PI=(1-positive serum OD 450 nm value / negative serum OD 450 nm value) × 100%, the antigen coating concentration and enzy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of clinical immunology, and discloses a monoclonal antibody of actinobacillus pleuropneumoniae rApxIVAN and application thereof. Partial fragments of ApxIVgene are effectively intercepted and mutated, and the obtained genes can be efficiently expressed in escherichia coli and can also be expressed in supernate. Expressed and purified rApxIVAN are usedas an antigen to prepare the monoclonal antibody, an indirect competitive ELISA antibody detection method for actinobacillus pleuropneumoniae is established, and the specificity is improved. The method of the invention can not only used to detect and monitor all APP serotype antibodies, but also distinguish wild virus infection and existing vaccine immunity, which provides a powerful tool for effect evaluation and purification of swine infectious pleuropneumonia vaccines.

Description

technical field [0001] The invention belongs to the technical field of clinical immunology, and relates to a monoclonal antibody of Actinobacillus pleuropneumoniae rApxIVAN and application thereof. Background technique [0002] Actinobacillus pleuropneumoniae (APP) is the main pathogen of porcine contagious pleuropneumonia, which can cause acute hemorrhagic fibrinous pleuropneumonia and chronic fibrinous necrotizing pleuropneumonia in pigs. Porcine contagious pleuropneumonia is a highly contagious respiratory infectious disease. It is an explosive epidemic. The most acute or acute morbidity and mortality are more than 50%. It is one of the main reasons for the death of fattening pigs and breeding pigs; The chronic type can cause pigs to grow slowly and become stiff pigs, which seriously affects economic benefits. Moreover, because porcine infectious pleuropneumonia often produces mixed infection or secondary infection and epidemic with immunosuppressive diseases such as por...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/20C07K16/12G01N33/68G01N33/577G01N33/569G01N33/543
CPCC07K16/1203G01N33/6854G01N33/577G01N33/56911G01N33/54306G01N2469/20Y02A50/30
Inventor 袁芳艳田永祥刘泽文刘威周丹娜杨克礼段正赢郭锐高婷
Owner INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com