Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

TaqMan probe fluorescent quantitative PCR kit for Nipah virus and application thereof

A Nipah virus and fluorescence quantitative technology, which is applied in the determination/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of shortening operation time, unclear detection sensitivity, complex reaction system preparation, etc., and achieve repeatability Good performance, strong sensitivity, and the effect of meeting the requirements of qualitative and quantitative detection

Active Publication Date: 2021-03-16
SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the detection sensitivity of N gene detection in existing reports is still unclear, and the preparation of the reaction system is relatively complicated. A fluorescent PCR detection method for Nipah virus N gene cDNA developed in this study further optimizes the reaction system. The reaction master mix containing the primer probe is added to the reaction tube, and then 1 μL of the sample nucleic acid cDNA template is added to perform the PCR reaction, which greatly shortens the operation time and reduces cross-contamination between samples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • TaqMan probe fluorescent quantitative PCR kit for Nipah virus and application thereof
  • TaqMan probe fluorescent quantitative PCR kit for Nipah virus and application thereof
  • TaqMan probe fluorescent quantitative PCR kit for Nipah virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1 The establishment of qPCR reaction system

[0039] Download the N (nucleocapsid protein) gene (ID: AJ627196.1) sequence of Nipah virus from GenBank, and design a specific primer NiV-qF at 774 ~ 905 bp: 5'- TCTCCCAGAGTCTATCAGTAAGG -3' (SEQ ID No .1), NiV-qR: 5'- CCATACCAGTTTCCTCGACATAG -3' (SEQ ID No.2) and probe NiV-Probe: FAM-5'- AGGATCTGCTAAAGGCAGAGCAGT-3'-BHQ1 (SEQ ID No.3), the target fragment It is 132 bp; the synthetic vector is a recombinant plasmid of pUC57, the concentration is calculated according to the molecular weight and converted into copies / μL, and the template with the calculated copy number is diluted 10 times to prepare a standard. Primers, probes and plasmids were synthesized by Shanghai Sangon Bioengineering Co., Ltd.

[0040] Table 1: Primer and Probe Sequences

[0041]

[0042] Follow Novazym AceQ U + Probe Master Mix manual TaqMan qPCR reaction system Test reaction: 2×AceQ U + Probe Master Mix: 10 μL, NiV-qF (10 μM): 0.4 μL,...

Embodiment 2

[0049] Example 2 Sensitivity detection of qPCR reaction system

[0050] Dilute the NiV plasmid according to a 10-fold serial gradient, and perform a qPCR test according to the optimized reaction conditions to detect the sensitivity; each concentration gradient is repeated three times, and the standard curve is drawn with the obtained Ct value and the coefficient of variation (CV) is calculated to evaluate the method. repeatability. The total length of the NiV recombinant plasmid is 4299bp, and the concentration of the detected plasmid is 7ng / μL; the copy number of the standard product calculated according to the formula is 6.02×10 23 copies / mol×(7 ng / μL×10 -9 ) / (4299 ×660 g / mol)=1.48×10 9 copies / μL. with ddH 2 O 10-fold serial dilution to 1.48×10 1 copies / μL. Take 1 μL of the diluted standard plasmid as a template, and perform amplification according to the optimized qPCR conditions. The standard curve is as follows: figure 1 Shown: Y = -3.27×X+38.673 (R 2 =0.996)....

Embodiment 3

[0051] The specific detection of embodiment 3qPCR reaction system

[0052] Common infectious pathogen DNA or cDNA include: African swine fever virus (ASFV), porcine reproductive and respiratory syndrome virus (PRRSV), swine fever virus (CSFV), porcine pseudorabies virus (PRV), porcine epidemic diarrhea ( PED) etc. for qPCR detection to evaluate the specificity of the method.

[0053] Standards with different copy numbers (1.48×10 9 ~1.48×10 0 copies / μL) were measured three times, and the test results were statistically analyzed to test the repeatability of the method. The results are shown in Table 4. The coefficient of variation (CV; the ratio of the standard deviation to the mean) is less than 2%, indicating that the established method has good repeatability and stable results. as table 4 and figure 2 As shown, the lowest NiV plasmid concentration that can be detected by the established qPCR detection method for N gene is 14.8 copies / μL. At present, the fluorescent RT-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
correlation coefficientaaaaaaaaaa
Login to View More

Abstract

The invention provides a TaqMan probe fluorescent quantitative PCR kit for Nipah virus and application thereof, wherein the sequences of the included primer and probe are as follows: a forward primerNiV-qF: 5'-TCTCCCAGAGTCTATCAGTAAGG-3'; a reverse primer NiV-qR: 5'-CCATACCAGTTTCCTCGACATAG-3', a probe NiV-Probe: FAM-5'-AGGATCTGCTAAAGGCAGAGCAGT-3'-BHQ1. The invention also provides a method for detecting the Nipah virus by using the reagent through in-vitro fluorescent PCR, and the Nipah virus can be rapidly and accurately detected. The Nipah virus fluorescence PCR detection method established by the invention has the advantages of simple and convenience in operation, high efficiency, quickness and specificity. According to the establishment of the method, the detection of samples can be completed within about 2 hours, the sensitivity can reach 14.8 copies / mu L, and the blank of domestic detection of the Nipah virus is filled up.

Description

technical field [0001] The invention belongs to the field of biological detection, and specifically relates to a TaqMan probe fluorescence quantitative PCR (qPCR) detection kit for Nipah virus (NiV) cDNA based on Nipah virus (NiV) N gene as a target and its application. Background technique [0002] Nipah virus (Nipah virus, NiV) is an enveloped single-stranded negative-sense RNA virus, Paramyxoviridae, Henivirus genus, which has the characteristics of wide host range and high lethality. It was first discovered in Malaysia in 1998. Nipah virus infection is a zoonotic natural foci disease. It once broke out in Singapore, Malaysia, India and other countries, causing huge economic losses to the pig industry. The World Health Organization listed Nipah virus in 2018. A limited list of diseases that pose a serious threat to public health. The current global outbreak of Nipah virus infection originated from the same virus strain, which evolved due to genetic variation during trans...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/701C12Q1/686C12Q2563/107C12Q2545/114C12Q2561/101Y02A50/30
Inventor 陈鸿军孙彤孙竹筠陆珂苏苌李娓
Owner SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com