Alpha-glycosidase gene mutant and application thereof in preparation of 2-O-alpha-D-glucosyl-L-ascorbic acid

A technology of ascorbic acid and 2-O-, which is applied in the field of α-glucosidase mutants, can solve the problems of less research and achieve the effect of improving enzyme activity, improving conversion rate and product quantity

Active Publication Date: 2021-04-23
NANJING TECH UNIV
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But there are few related studies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alpha-glycosidase gene mutant and application thereof in preparation of 2-O-alpha-D-glucosyl-L-ascorbic acid
  • Alpha-glycosidase gene mutant and application thereof in preparation of 2-O-alpha-D-glucosyl-L-ascorbic acid
  • Alpha-glycosidase gene mutant and application thereof in preparation of 2-O-alpha-D-glucosyl-L-ascorbic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Construction of recombinant vector (pGAP9K-AGL)

[0036] from Oryza sativa subsp. japonica (Rice) The α-glucosidase gene, whose nucleotide sequence is shown in SEQ ID NO.2, was synthesized by Nanjing GenScript Technology Co., Ltd. (GenScript) and then cloned into the restriction endonucleic acid of the eukaryotic expression vector pGAP9K enzyme site EcoRI After that, and add a 6-his tag to its N-terminus, the recombinant vector pGAP9K-AGL (refer to figure 1 ).

Embodiment 2

[0037] Embodiment 2: Preparation of α-glucosidase mutant

[0038] According to the nucleotide sequence of α-glucosidase as shown in sequence SEQ NO.2, primers introducing Y270F, W373L, M411F, R491K and W504L mutations were designed and synthesized, and site-directed mutagenesis kit (Vazyme. Co.) was used to The obtained recombinant plasmid pGAP9K-AGL of embodiment 1 is template, through PCR amplification, product DpnI Digestion, recombinant transformation, plasmid extraction, sequencing verification and other steps obtained the mutant recombinant plasmids pGAP9K-AGL-Y270F, pGAP9K-AGL-W373L, pGAP9K-AGL-M411F, pGAP9K-AGL-R491K and pGAP9K mutated at the corresponding sites -AGL-W504L.

[0039] The site-directed mutagenesis primers for introducing the Y270F mutation are (underlined are mutated bases):

[0040] Forward primer: SEQID NO.8 5’ TGTAGA TTC GGTTATAAGAACGTTGCTGATT 3’

[0041] Reverse primer: SEQID NO.9 5'ATAACC GAA TCTACATTGGTGAAAACCGAA 3’

[0042] The site-direc...

Embodiment 3

[0055] Embodiment 3: Shake flask fermentation produces enzyme

[0056] The recombinant Pichia strains Y270F, W373L, M411F, R491K and W504L obtained in Example 2 were inoculated in YPD medium respectively, and after being cultivated at 30° C. for 24 h, they were transferred to 50 mL of BMGY medium with 10% inoculum size. Cultivate in a shaker at 30°C and 200rpm for 18 hours, then centrifuge at 4000rpm for 5min, discard the supernatant, collect the bacteria, hang the bacteria with 200 mL of BMGY medium, and culture in a constant temperature shaker at 30°C for 72h, supplemented every 12h Supplement the final concentration of 1% glucose as carbon source. After the shake flask fermentation is finished, centrifuge at 5000rpm for 20min, and the supernatant is the crude enzyme solution of the desired α-glucosidase mutants Y270F, W373L, M411F, R491K and W504L. The recombinant Pichia pastoris strains with higher protein expression and higher enzyme activity were selected for continuous...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an alpha-glycosidase gene mutant and application thereof in preparation of 2-O-alpha-D-glucosyl-L-ascorbic acid, and the alpha-glycosidase gene mutant is prepared by mutating tyrosine at 270 into phenylalanine, or / and mutating tryptophan at 373 into leucine, or / and mutating methionine at 411 into phenylalanine, or / and mutating tryptophan at 273 into leucine, or / and mutating methionine at 411 into leucine. Or / and mutating arginine at the 491st site into lysine, or / and mutating tryptophan at the 504th site into leucine. The mutant is simple to prepare, and the yield of AA-2G generated through catalysis is improved. Under the same conditions, the specific activity of the mutant is obviously improved compared with that of the original enzyme, the highest yield of AA-2G generated through catalysis can reach 18.9 g / L, and the conversion rate of AA-2G is obviously improved compared with that of the original enzyme.

Description

technical field [0001] The invention belongs to the field of genetic engineering and enzyme engineering, in particular to a Oryza sativa Use of α-glucosidase mutants in the preparation of 2-O-α-D-glucosyl-L-ascorbic acid (AA-2G). Background technique [0002] L-Ascorbic acid (also known as vitamin C, VC) is a water-soluble vitamin that cannot be synthesized by the human body itself. It participates in various physiological activities in the body, such as promoting the conversion of cholesterol into bile acids, promoting the synthesis of adrenal cortex hormones, and participating in aromatic amino acids. Metabolism of iron, promotion of iron absorption and participation in various redox reactions in the body, etc., play an important role in maintaining and promoting human health. However, the hydroxyl group at its C-2 position is extremely unstable, and it is very prone to oxidative degradation under conditions such as oxygen, heat, light, and heavy metals, resulting in weak...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/24C12N15/56C12N15/81C12N1/19C12P19/60C12R1/84
CPCC12N9/2402C12Y302/0102C12N15/815C12P19/60
Inventor李艳贾红华齐雪莲余杰邵俊澜严明
OwnerNANJING TECH UNIV