Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lepidoptera insect Hpx12 gene and application

A Lepidoptera insect and gene technology, applied in the field of genetic engineering, can solve the problems of ecological deterioration, insecticide resistance, etc.

Active Publication Date: 2021-04-23
ZHENGZHOU UNIVERSITY OF LIGHT INDUSTRY
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It is of positive significance to solve the problems of ecological deterioration and pesticide resistance caused by chemical pesticides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lepidoptera insect Hpx12 gene and application
  • Lepidoptera insect Hpx12 gene and application
  • Lepidoptera insect Hpx12 gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Hpx12 gene cloning

[0039] (1) According to Anopheles Hpx12 Gene (Gen Bank accession number (XP_311449) protein sequence, search NCBI database to obtain homologous gene in silkworm Hpx12 sequence.

[0040] Regulatory genes of the innate immune response in lepidopteran insects Hpx12 The nucleotide sequence of is shown in SEQ ID NO.1.

[0041]Use this sequence to design gene cloning primer ID No.4 - SEQ ID No.5;

[0042] Forward primer: 5'-CG GGATCC GTTCGCTATGAATCGTTTTC-3'; SEQ ID No. 4;

[0043] Reverse primer: 5'-GGG TTCGAA TTAGTTGCAGCTTTAAAATCATTAA-3'; SEQ ID No. 5.

[0044] B. Extract the whole silkworm RNA of silkworm, and reverse transcribe to obtain the first-strand cDNA;

[0045] C. According to Hpx12 For the gene sequence, use primers SEQ ID No.4 - SEQ ID No.5, and use the first-strand cDNA obtained by reverse transcription as a template for PCR amplification. TransStart high-fidelity amplification enzyme reaction system is selected, and the total vo...

Embodiment 2

[0048] Lepidoptera Hpx12 Synthesis and microinjection of gene dsRNA

[0049] The Lepidoptera insect obtained by cloning according to Example 1 Hpx12 The full-length sequence SEQ ID NO.1 in the gene, designed Hpx12 The ds RNA of the gene is synthesized by in vitro transcription reagents, and the ds RNA sequence is SEQ ID No.3. Specifically, the primers SEQ ID No.6-SEQ ID No. are designed through the RiboMAX Large Scale RNA Production System-T7 kit. 7;

[0050] Forward primer: 5'-GTAATACGACTCACTATAGGGAGAGTTCGCTAT

[0051] GAATCGTTTTC-3'; SEQ ID No. 6;

[0052] Reverse primer: 5'- GTAATACGACTCACTATAGGGAGATTAGTTGCAGCTT

[0053] TAAAATCATTAA-3'; SEQ ID No. 7.

[0054] Bombyx mori larvae of 5 instar and 2 days old with uniform size and health status were selected, and dsGFP-injected control group and dsHpx12-injected experimental group were set up. Before injection, silkworm larvae were anesthetized on ice, and then dsRNA synthesized in vitro was injected into In the body cav...

Embodiment 3

[0057] Lepidoptera Hpx12 The dsRNA of the gene will inhibit the innate immune response of the worm and increase the susceptibility of the worm to pathogens

[0058] Use 75% ethanol to disinfect the surface of the 5th instar and 3-day-old larvae of the silkworm. Inject 2ml of BmNPV into the blood cavity of silkworms injected with dsRNA with a micro-syringe. After standing at 25°C for 2h, the melanin and dark nodules were counted under a microscope with a magnification of 50 times. Control insects were injected with only 2 ml of BmNPV. Each test method was repeated three times. image 3 . Depend on image 3 It can be seen that compared with the control group, the number of nodules in the treatment group injected with dsRNA was significantly reduced, indicating that Lepidoptera insects Hpx12 After the expression of the gene was suppressed, the immunity of the silkworm was greatly reduced.

[0059] Fluorescent quantitative PCR was used to detect the expression of antimicrob...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a lepidoptera insect Hpx12 gene and application. The first purpose of the invention is to provide a lepidoptera insect innate immune response regulation gene Hpx12; the second purpose is to provide a cloning method of the lepidoptera insect innate immune response regulation gene Hpx12; and the third purpose is to provide the application of the lepidoptera insect innate immune response regulation gene Hpx12. According to the invention, after the expression of the lepidoptera insect Hpx12 gene is inhibited, the innate immune response of insect bodies can be inhibited, the susceptibility of the insect bodies to germs is increased, silkworms are more easily infected with BmNPV viruses, and the death rate of lepidoptera insects is further greatly increased. If the expression of lepidoptera insects Hpx12 is inhibited, the purpose of pest control can be achieved. The lepidoptera insect Hpx12 gene has positive significance in solving the problems of ecological deterioration, insecticide resistance and the like caused by chemical insecticides.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a lepidopteran insect Hpx12 Genes and applications. Background technique [0002] Lepidoptera includes two classes of insects, moths and butterflies, belonging to the subclass Pteroptera and holometabolism. About 200,000 species are known in the world, and more than 8,000 species are known in China. This order is the second largest order in the class Insecta after Coleoptera. The distribution range is extremely wide, and the tropical species is the most abundant. Most types of larvae damage all kinds of cultivated plants, and the larger ones often eat up the leaves or drill into the branches. Smaller ones tend to curl leaves, adorn leaves, form sheaths, spin silk and form nets, or drill into plant tissues to feed and cause damage. There are many important pests, such as peach borer, apple leaf tortrix, cotton bollworm, cabbage butterfly, diamondback moth, and m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/53C12N9/08C12N15/10C12N15/113A01N57/16A01P7/04
Inventor 时桂芹任菲郭法谋周园沈佳鑫
Owner ZHENGZHOU UNIVERSITY OF LIGHT INDUSTRY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More