Application of cotton GhHDA6 gene in regulating and controlling flowering period of plants
A gene and cotton technology, applied in the application field of cotton GhHDA6 gene in regulating plant flowering period, can solve the problem of lack of systematic research on cotton RPD3 gene family
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] The bioinformatics analysis of embodiment 1 cotton GhHDA6
[0050] Obtain the CDS sequence and encoded amino acid sequence of GhHDA6 (Ghir_D03G01151) gene from CottonFGD (http: / / www.cottonfgd.org / ), its open reading frame is 1416bp, encodes 472 amino acids, has 6 exons and 5 introns. The relative molecular mass of the protein is 53.06kDa, and the isoelectric point is 5.1. The domain prediction website SMART (http: / / smart.embl-heidelberg.de / ) was used to predict that the gene contained a conserved domain Hist_deacetyl, and the gene was highly homologous to the Arabidopsis histone deacetylase AtHDA6 ( figure 1 ), we named the gene GhHDA6, and studied its function.
[0051] The open reading frame sequence of GhHDA6 is as follows:
[0052] ATGGAAGACTCTGCTGGAGGCGCATCATTACGGTCGGGTCCCGACGGGAAGAAGCGGCGTGTGACATACTTCTACGAGCCAACGATCGGCGACTACTATTACGGTCAGGGTCACCCGATGAAACCCCACCGGATTCGTATGGCACACAATCTCATCGTCCATTATTCTCTCCACCGTCGGATGGAGATTAACCGTCCTTTCCCCGCCGGTCCCGACGACATCCGTCGCTTTCACA...
Embodiment 2
[0055] Expression pattern analysis of embodiment 2GhHDA6
[0056] In order to study the potential function that the GhHDA6 gene may have, the RNA-seq data of leaves, roots, stems, calyxes, petals, pistils, stamens and fibers of TM-1 were obtained from the NCBI database, using the transcriptome data from Upland Cotton Genome Research , calculate the FPKM value to represent the expression level of the gene, and analyze the spatiotemporal expression pattern of the GhHDA6 gene in different tissues. It was found that the GhHDA6 gene showed a high expression level in the reproductive organs, especially in the petals and pistils, indicating that the gene is related to the development of cotton flowers ( figure 2 in A).
Embodiment 3
[0057] Example 3 Differential analysis of the expression of GhHDA6 in the flower bud differentiation stage of two materials of China Cotton Institute 36 and G2005
[0058] 1 grinding sample
[0059] Put the terminal buds from the one-leaf stage to the five-leaf stage of Zhongmiansuo 36 and G2005 materials in liquid nitrogen, grind them to powder with a mortar and grinding rod, take about 100mg of samples and put them in a 1.5mL centrifuge tube .
[0060] 2 RNA extraction
[0061] All following centrifugation steps were performed at room temperature.
[0062] (1) Homogenization treatment: Add 700 μl of lysate SL (beta-mercaptoethanol is added before use) to the ground sample, and shake vigorously immediately to mix the sample. Note 1: For plant samples whose RNA yield is expected to be less than 10 μg, please use an initial sample volume of 100 mg; for samples rich in starch or mature leaves, please increase the amount of Lysis SL to 700 μl. Note 2: Since the plant diversit...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com