Application of cotton GhHDA6 gene in regulating and controlling flowering period of plants

A gene and cotton technology, applied in the application field of cotton GhHDA6 gene in regulating plant flowering period, can solve the problem of lack of systematic research on cotton RPD3 gene family

Active Publication Date: 2021-04-30
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is currently a lack of systematic research on the cotton RPD3 gene family

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of cotton GhHDA6 gene in regulating and controlling flowering period of plants
  • Application of cotton GhHDA6 gene in regulating and controlling flowering period of plants
  • Application of cotton GhHDA6 gene in regulating and controlling flowering period of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] The bioinformatics analysis of embodiment 1 cotton GhHDA6

[0050] Obtain the CDS sequence and encoded amino acid sequence of GhHDA6 (Ghir_D03G01151) gene from CottonFGD (http: / / www.cottonfgd.org / ), its open reading frame is 1416bp, encodes 472 amino acids, has 6 exons and 5 introns. The relative molecular mass of the protein is 53.06kDa, and the isoelectric point is 5.1. The domain prediction website SMART (http: / / smart.embl-heidelberg.de / ) was used to predict that the gene contained a conserved domain Hist_deacetyl, and the gene was highly homologous to the Arabidopsis histone deacetylase AtHDA6 ( figure 1 ), we named the gene GhHDA6, and studied its function.

[0051] The open reading frame sequence of GhHDA6 is as follows:

[0052] ATGGAAGACTCTGCTGGAGGCGCATCATTACGGTCGGGTCCCGACGGGAAGAAGCGGCGTGTGACATACTTCTACGAGCCAACGATCGGCGACTACTATTACGGTCAGGGTCACCCGATGAAACCCCACCGGATTCGTATGGCACACAATCTCATCGTCCATTATTCTCTCCACCGTCGGATGGAGATTAACCGTCCTTTCCCCGCCGGTCCCGACGACATCCGTCGCTTTCACA...

Embodiment 2

[0055] Expression pattern analysis of embodiment 2GhHDA6

[0056] In order to study the potential function that the GhHDA6 gene may have, the RNA-seq data of leaves, roots, stems, calyxes, petals, pistils, stamens and fibers of TM-1 were obtained from the NCBI database, using the transcriptome data from Upland Cotton Genome Research , calculate the FPKM value to represent the expression level of the gene, and analyze the spatiotemporal expression pattern of the GhHDA6 gene in different tissues. It was found that the GhHDA6 gene showed a high expression level in the reproductive organs, especially in the petals and pistils, indicating that the gene is related to the development of cotton flowers ( figure 2 in A).

Embodiment 3

[0057] Example 3 Differential analysis of the expression of GhHDA6 in the flower bud differentiation stage of two materials of China Cotton Institute 36 and G2005

[0058] 1 grinding sample

[0059] Put the terminal buds from the one-leaf stage to the five-leaf stage of Zhongmiansuo 36 and G2005 materials in liquid nitrogen, grind them to powder with a mortar and grinding rod, take about 100mg of samples and put them in a 1.5mL centrifuge tube .

[0060] 2 RNA extraction

[0061] All following centrifugation steps were performed at room temperature.

[0062] (1) Homogenization treatment: Add 700 μl of lysate SL (beta-mercaptoethanol is added before use) to the ground sample, and shake vigorously immediately to mix the sample. Note 1: For plant samples whose RNA yield is expected to be less than 10 μg, please use an initial sample volume of 100 mg; for samples rich in starch or mature leaves, please increase the amount of Lysis SL to 700 μl. Note 2: Since the plant diversit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention provides application of a cotton GhHDA6 gene in regulation and control of a flowering period of a plant, and relates to the technical field of biology. According to the invention, research results show that a GhHDA6 gene is cloned from upland cotton, an overexpression vector of the gene is constructed, arabidopsis thaliana is transfected, and the obtained overexpression transgenic arabidopsis thaliana blooms earlier than wild arabidopsis thaliana; and a virus-induced silencing vector of the gene is constructed, and cotton 36 in upland cotton is injected, so that the flowering delay of an obtained silencing cotton plant is delayed, and the GhHDA6 gene plays an important role in regulating and controlling the flowering period of the cotton.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of cotton GhHDA6 gene in regulating the flowering period of plants. Background technique [0002] Cotton is one of the most important economic crops in our country, and cotton planting occupies a pivotal position in our national economy. Early maturation is an important target trait of cotton breeding. The use of early maturing cotton can not only increase the land multiple cropping index and expand the cotton planting area, but also avoid natural disasters, reduce pesticide pollution, and achieve coordinated development and common improvement of economic and ecological benefits (Yu Shuxun et al ., 2017). Growth period is the most concerned trait in cotton early-maturing breeding, and flowering period is one of the important growth period traits. Flowering is a sign of the transition of cotton from vegetative growth to reproductive growth. Timely flowering can not o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/02A01H6/60A01H6/20
CPCC07K14/415C12N15/827
Inventor 喻树迅张晶晶王寒涛魏恒玲付小康马亮
Owner INST OF COTTON RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap