Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Composition for detecting BVDV1 type in bovine semen, kit and application

The technology of a composition and a kit, which is applied in the field of detection of BVDV1 type composition in bovine semen, can solve the problems of poor sensitivity and non-detection, and achieve the effects of good stability, high reproducibility and good primer specificity

Pending Publication Date: 2021-06-11
GUANGDONG OCEAN UNIVERSITY +1
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the domestic detection methods for BVDV1 in bovine semen are molecular biological detection methods, mainly including conventional PCR method and fluorescent quantitative PCR method. When the pathogen content in bovine semen is extremely small, there is a phenomenon that it cannot be detected
At present, there is no method for detecting BVDV1 type by ddPCR technology, and based on the problems of poor sensitivity in the detection of BVDV1 type in the existing technology, it is urgent to establish an ultra-sensitive, stable and rapid detection method suitable for the detection of BVDV1 type in bovine semen

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Composition for detecting BVDV1 type in bovine semen, kit and application
  • Composition for detecting BVDV1 type in bovine semen, kit and application
  • Composition for detecting BVDV1 type in bovine semen, kit and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1B

[0031] The establishment of embodiment 1BVDV1 type ddPCR method

[0032] 1. Design of primers and probes

[0033] The 5'-UTR gene sequence of BVDV published by GenBank (accession number: AJ304384.1\EU180029.1\GU395536.1\KF205297.1\LT901625.1MF347399.1\MG323524.1\MG670546.1\MH198309. 1) Sequence alignment was performed to further determine the conserved region of the BVDV 5'-UTR gene (its sequence is shown in SEQ ID NO: 4). According to the conserved region, a pair of BVDV primers and a Taqman probe were designed and synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. The specific sequences are shown in Table 1.

[0034] Wherein SEQ ID NO: 4:

[0035]AGGCTAGCCATGCCCTTAGTAGGACTAGCAAAATGAGGGGGGTAGCAACAGTGGTGAGTTCGTTGGATGGCTGAAGCCCTGAGTACAGGGCAGTCGTCAGTGGTTCGACACCTAGGATGGTAGGTCTCGAGATGCCACGTGGACGAGGGCATGCCACAGCACATCTTAGCCTGAGCGGGGGTCGCCCAGGTGAAAGCAGGTACAGACAGAACCCGCTGCT

[0036] Table 1 Sequences of primers and probes for ddPCR detection of BVDV1

[0037]

[0038] 2. ...

Embodiment 2

[0049] Embodiment 2 fluorescence quantitative PCR method detects the effectiveness of primers and probes

[0050] Using the above ddPCR primers and probes, using the TransStart Probe qPCR SuperMix kit (Beijing Quanshijin Biotechnology Co., Ltd.), the fluorescent quantitative PCR experiment was carried out according to the 25 μL reaction system, as shown in Table 2.

[0051] Table 2 25 μL fluorescent quantitative PCR reaction system

[0052]

[0053] The reaction conditions are: 94°C for 30 sec; 94°C for 5 sec, 58°C for 30 sec, a total of 40 cycles.

[0054] The experimental results show that the linear relationship is good, and the minimum detection concentration is 1×10 within 40 cycles. 2 copies / μL see figure 2 . The result shows that the designed primers and probes for detecting BVDV1 type are effective and can be used in ddPCR method.

Embodiment 3d

[0055] Embodiment 3 ddPCR method sensitivity detection

[0056] According to the detection results of fluorescent quantitative PCR, ddPCR detection was performed after removing high-concentration templates exceeding the dynamic range of ddPCR to determine the detection sensitivity of the established method. The specific detection method is the same as the establishment of ddPCR in Example 1, the optimized reaction parameters, and the establishment of a sensitivity detection test.

[0057] The test results showed that the minimum detection concentration of positive plasmids by ddPCR was 1×10 0 copies / μL, more sensitive than fluorescent quantitative PCR method, see image 3 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a composition for detecting BVDV1 type in bovine semen, a kit and application, and belongs to the technical field of virus detection. The composition comprises a primer pair and a probe, the primer pair has nucleotide sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2, the probe has a nucleotide sequence as shown in SEQ ID NO: 3, the 5'end of the probe is connected with FAM, and the 3 'end of the probe is connected with BHQ1. On the basis of a micro-droplet digital PCR technology, the BVDV1 type in the bovine semen is specifically detected by using the primer and the probe, and the lowest detection limit can be as low as 1 copies / mu L; under a low copy number, compared with a conventional fluorescent quantitative PCR method, the detection microdroplet type digital PCR method provided by the invention is more sensitive, the generation of false negative is reduced, the specificity, sensitivity and absolute quantitative detection of the bovine BVDV1 type are realized, and a new detection method is provided for animal quarantine related detection departments and enterprises.

Description

technical field [0001] The invention relates to the technical field of virus detection, and relates to a composition, a kit and an application for detecting BVDV1 in bovine semen. Background technique [0002] Bovine viral diarrhea virus (BVDV) is a Pestivirus virus belonging to the family Flaviviridae. According to the 5'-UTR gene sequence of the virus, BVDV can be divided into BVDV1 type and BVDV2 type. The virus can cause bovine viral diarrhea disease (BVD), and can also infect other ruminants such as pigs, sheep, and deer, causing symptoms such as respiratory, gastrointestinal system diseases, and abortion in female animals; at the same time, BVDV can cause immunosuppression and easy Secondary to other infectious diseases, the mortality rate is extremely high; it causes huge economic losses to the breeding industry, and is a key object of animal quarantine worldwide. The List of Quarantine and Epidemic Diseases of Imported Animals of the People's Republic of China lists...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/93
CPCC12Q1/701C12Q1/686C12Q2563/159C12Q2563/107
Inventor 于志超赵治国陈林军延涵崔强巨向红雍艳红马兴斌刘晓曦
Owner GUANGDONG OCEAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com