Composition for detecting BVDV1 type in bovine semen, kit and application
The technology of a composition and a kit, which is applied in the field of detection of BVDV1 type composition in bovine semen, can solve the problems of poor sensitivity and non-detection, and achieve the effects of good stability, high reproducibility and good primer specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1B
[0031] The establishment of embodiment 1BVDV1 type ddPCR method
[0032] 1. Design of primers and probes
[0033] The 5'-UTR gene sequence of BVDV published by GenBank (accession number: AJ304384.1\EU180029.1\GU395536.1\KF205297.1\LT901625.1MF347399.1\MG323524.1\MG670546.1\MH198309. 1) Sequence alignment was performed to further determine the conserved region of the BVDV 5'-UTR gene (its sequence is shown in SEQ ID NO: 4). According to the conserved region, a pair of BVDV primers and a Taqman probe were designed and synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. The specific sequences are shown in Table 1.
[0034] Wherein SEQ ID NO: 4:
[0035]AGGCTAGCCATGCCCTTAGTAGGACTAGCAAAATGAGGGGGGTAGCAACAGTGGTGAGTTCGTTGGATGGCTGAAGCCCTGAGTACAGGGCAGTCGTCAGTGGTTCGACACCTAGGATGGTAGGTCTCGAGATGCCACGTGGACGAGGGCATGCCACAGCACATCTTAGCCTGAGCGGGGGTCGCCCAGGTGAAAGCAGGTACAGACAGAACCCGCTGCT
[0036] Table 1 Sequences of primers and probes for ddPCR detection of BVDV1
[0037]
[0038] 2. ...
Embodiment 2
[0049] Embodiment 2 fluorescence quantitative PCR method detects the effectiveness of primers and probes
[0050] Using the above ddPCR primers and probes, using the TransStart Probe qPCR SuperMix kit (Beijing Quanshijin Biotechnology Co., Ltd.), the fluorescent quantitative PCR experiment was carried out according to the 25 μL reaction system, as shown in Table 2.
[0051] Table 2 25 μL fluorescent quantitative PCR reaction system
[0052]
[0053] The reaction conditions are: 94°C for 30 sec; 94°C for 5 sec, 58°C for 30 sec, a total of 40 cycles.
[0054] The experimental results show that the linear relationship is good, and the minimum detection concentration is 1×10 within 40 cycles. 2 copies / μL see figure 2 . The result shows that the designed primers and probes for detecting BVDV1 type are effective and can be used in ddPCR method.
Embodiment 3d
[0055] Embodiment 3 ddPCR method sensitivity detection
[0056] According to the detection results of fluorescent quantitative PCR, ddPCR detection was performed after removing high-concentration templates exceeding the dynamic range of ddPCR to determine the detection sensitivity of the established method. The specific detection method is the same as the establishment of ddPCR in Example 1, the optimized reaction parameters, and the establishment of a sensitivity detection test.
[0057] The test results showed that the minimum detection concentration of positive plasmids by ddPCR was 1×10 0 copies / μL, more sensitive than fluorescent quantitative PCR method, see image 3 .
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com