Adenylation protein A6 mutant as well as coding gene and application thereof

A technology for adenylylating proteins and coding genes, which is applied in the field of catalytic synthesis of polymyxins, to achieve the effect of improving activity

Active Publication Date: 2021-08-20
ZHEJIANG UNIV OF TECH
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the key residues related to substrate recognition in the A domain of NRPS module 6 of polymyxin have not been identified, how to determine the active site of the A domain and modify it, so as to obtain more novel polymyxins with important biological activities Mycocin, with great industrial prospects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Adenylation protein A6 mutant as well as coding gene and application thereof
  • Adenylation protein A6 mutant as well as coding gene and application thereof
  • Adenylation protein A6 mutant as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1: Construction of Unmatched Adenosine Acid Protein A6 Expression Plasmid

[0048] (1) The total genome (CICC 21777) total genome preserved in laboratory is a template, and the upper and lower proders F / R with PET-28A (+) recombinant homologous fragments are designed for PCR amplification, PCR product. Use 1%

[0049] Agarose gel electrophoresis test. The purpose of the drug was detected after a discovery product was used to recover the segment of the agent.

[0050] F: ctttaagaaggagatataatgctttgaaaaagaaacg

[0051] R: ctcgagTGCGCCGCAAGCCGCGGCTTCATGCGGGGAGC

[0052] (2) Excipient expression plasmid PET-28A (+), use NCO I and ECOR I bisase to recover the spare.

[0053] (3) The above-mentioned recovery alternate carrier and fragment were recombined with a SOSOO kit and transferred into E. coli DH5α sensitive cells to obtain recombinant expression plasmid PET-28A + A6 clonal strains.

Embodiment 2

[0054] Example 2: By sequence alignment prediction key amino acid residues

[0055] To predict the key residue associated with adenproprin and the substrate binding pocket, 5 of the five types of GRSA, SLGN1, CMIS6, IDNL1 and DLTA have been downloaded by NCBI, and the amino acid sequence of the protein structure and the active site of the active site has been downloaded. Their PBD numbers are 1 amu, 4gr5, 5jjp, 5jjq, 3dHV. These amino acid sequences and amino acid sequences of A6 in Example 1 and the amino acid sequence (GenBank: JN660148.1) of adenprory domain B-A6 in the amino acid sequence (GenBank: JN660148.1) encoding a polymyxin B biosynthesis gene cluster module 6 For the preliminary screening, the key residue may be related to the specificity of the Module A domain as shown in Table 1.

[0056] Table 1: Results of the predicted active site by multi-sequence alignment

[0057]

[0058] Conclusion: Adenosine acylated protein A6 (SEQ ID NO.1) and online reported adenosine a...

Embodiment 3

[0059] Example 3: Construction of adenylated protein mutant expression plasmid

[0060] (1) The PET-28A + A6 expression plasmid constructed in Example 1 was a template, and the fixed-point mutant primers I493T-F / R, V514I-F / R, G516A-F / R, V546A-F / R were designed. To the PCR. The specific fixed point mutant primers are as follows (underscore mutant sites):

[0061] I493T-F: a G Tcgccccgtaatcgcat

[0062] I493T-R: atgcgattacggcgggcga C TTTGCCCCCAACGTACAG

[0063] V514i-f: TA T Gagcttcgttaagctgg

[0064] V514i-r:

[0065] CCAGCTTAACGAAGCTC A TaacgggaggctctGcgggg

[0066] G516A-F: T G CCGTTACGAGCTTCGTTA

[0067] G516A-R:

[0068] Taacgaagctcgtaacgg C Aggctctgcgggtatcggg

[0069] V546A-F: a G Caatcgaagcttcgggtag

[0070] V546A-R:

[0071] CTACCGAAGCTTCGATTG C Tacgccttgggatgccc

[0072] (2) The PCR product was tested with 1% agarose gel electrophoresis. The DPN I enzyme digestion template was detected after the purpose of the discovery was detected, and the segment of the kit was ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an adenylation protein A6 mutant as well as a coding gene thereof, and application of the adenylation protein A6 mutant as a key enzyme of an adenylation structural domain in catalytic synthesis of polymyxin. The adenylation protein A6 mutant is obtained by carrying out point mutation on the 516th amino acid of the adenylation protein A6 with an amino acid sequence as shown in SEQ ID NO.1. According to the mutant, gene engineering and enzyme engineering means are adopted to research the active site of the A domain, and the key amino acid residue (A6 516th site residue) related to the substrate specificity of the A domain is determined by constructing the mutant, such that the substrate specificity of the obtained mutant G516A is changed compared with the adenylation protein A6, the activity on L-Ala is substantially improved, an the activity to L-Arg appears, and it is proved that substrate recognition of adenylation protein can be changed by modifying the amino acid residues of the site, and a new way is provided for extension of the structure of polymyxin family compounds.

Description

[0001] (1) Technical field [0002] The present invention relates to a adenproprotein A6 mutant and its encoding gene, and its application as a tendr-based domain in catalytic synthesis polymyxin. [0003] (2) Background [0004] Multiponded Bacillus is a Gram-positive bacteria, and their metabolites are made as a last defense line of multi-resistant anti-pharmacoform, which has huge industrial value. In order to produce novel polycondensin with important biological activity, the related key enzymes of synthetic polyproducts are required, such as the key enzymes in non-nucleosome polypeptidase (NRPs) catalyzed by synthesis polyproducts - -A domain (adenprory domain). [0005] NRPS is a modular manner to assemble amino acid linear assembly, depending on the position of the NRPS different modules on the assembled line, it can be classified as the starting module, the extension module, or the stop module. The smallest extension module contains three core domains, C domains (condensatio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C07K7/62C12P21/04C12R1/19
CPCC12N9/1085C12N15/70C07K7/62C12Y205/01Y02A50/30
Inventor吴杰群朱梅芳章旭红储消和
OwnerZHEJIANG UNIV OF TECH