A kind of adenylated protein a6 mutant and its encoding gene and application

A technology for adenylylating proteins and coding genes, which is applied in the field of catalytic synthesis of polymyxins, to achieve the effect of improving activity

Active Publication Date: 2022-07-08
ZHEJIANG UNIV OF TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the key residues related to substrate recognition in the A domain of NRPS module 6 of polymyxin have not been identified, how to determine the active site of the A domain and modify it, so as to obtain more novel polymyxins with important biological activities Mycocin, with great industrial prospects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of adenylated protein a6 mutant and its encoding gene and application
  • A kind of adenylated protein a6 mutant and its encoding gene and application
  • A kind of adenylated protein a6 mutant and its encoding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Construction of unmutated adenylated protein A6 expression plasmid

[0043] (1) Using the total genome of Paenibacillus polymyxa (CICC 21777) preserved in the laboratory as a template, design the upstream and downstream primers F / R with homologous fragments recombined with pET-28a(+) for PCR amplification, and the PCR product use 1%

[0044] Agarose gel electrophoresis detection. After detecting the target product, use a small amount of DNA purification kit to recover the target fragment for future use.

[0045] F: CTTTAAGAAGGAGATATAATGGCTTTTTGAAAAAGAAACG

[0046] R: CTCGAGTGCGGCCGCAAGCCGCTCGGCTTCATTGCGGGGAGC

[0047] (2) The expression plasmid pET-28a(+) was extracted, digested with Nco I and EcoR I, and recovered for use.

[0048] (3) The above-mentioned recovery and standby vectors and fragments were recombined with SoSoo kit, and transferred into Escherichia coli DH5α competent cells to obtain recombinant expression plasmid pET-28a+A6 cloned strain. ...

Embodiment 2

[0049] Example 2: Prediction of key amino acid residues by sequence alignment

[0050] In order to predict the key residues related to the substrate-binding pocket of adenylylated proteins, the five amino acid sequences of GrsA, SlgN1, CmiS6, IdnL1, and DltA whose protein structures and active sites have been determined by X-ray diffraction were downloaded from NCBI. Their PBD numbers are 1AMU, 4GR5, 5JJP, 5JJQ, and 3DHV, respectively. These amino acid sequences were compared with the amino acid sequence of A6 in Example 1 and the amino acid sequence encoding the adenylation domain B-A6 in the polymyxin B biosynthesis gene cluster module 6 (GenBank: JN660148.1). Yes, the key residues that may be related to the substrate specificity of the A domain of this module from the preliminary screening are shown in Table 1.

[0051] Table 1: Results of active site prediction by multiple sequence alignment

[0052]

[0053] Conclusion: The laboratory-derived adenylation protein A6 (...

Embodiment 3

[0054] Example 3: Construction of adenylylated protein mutant expression plasmid

[0055] (1) Using the pET-28a+A6 expression plasmid constructed in Example 1 as a template, design site-directed mutagenesis primers I493T-F / R, V514I-F / R, G516A-F / R, and V546A-F / R to reverse to PCR. The specific site-directed mutagenesis primers are as follows (underlined are the mutation sites):

[0056] I493T-F: A G TCGCCGCCGTAATCGCAT

[0057] I493T-R: ATGCGATTACGGCGGCGA C TTTGCCTCCAACGTACAG

[0058] V514I-F: TA T GAGCTTCGTTAAGCTGG

[0059] V514I-R:

[0060] CCAGCTTAACGAAGCTC A TAACGGGAGGCTCTGCGGT

[0061] G516A-F: T G CCGTTACGAGCTTCGTTA

[0062] G516A-R:

[0063] TAACGAAGCTCGTAACGG C AGGCTCTGCGGTATCGGC

[0064] V546A-F: A G CAATCGAAGCTTCGGTAG

[0065] V546A-R:

[0066] CTACCGAAGCTTCGATTG C TACGACGCTTTGGGATGC

[0067] (2) PCR products were detected by 1% agarose gel electrophoresis. After detection of the target product, Dpn I enzyme was added to digest the template, and a s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an adenylation protein A6 mutant and its encoding gene, as well as its application as a key enzyme of adenylation domain in catalyzing the synthesis of polymyxin. Said adenylylated protein A6 mutant is obtained by point mutation of the 516th amino acid of adenylated protein A6 whose amino acid sequence is shown in SEQ ID NO.1. The present invention utilizes genetic engineering and enzyme engineering means to study the active site of the A domain, and determines the key amino acid residue (residue 516 of A6) related to the substrate specificity of the A domain by constructing a mutant. Compared with the adenylated protein A6, the obtained mutant G516A has changed substrate specificity, greatly improved the activity on L-Ala, and showed the activity on L-Arg, which proves that the amino acid residue at this site is subjected to Modifications that can alter the substrate recognition of adenylylated proteins provide a new avenue for structural expansion of the polymyxin family of compounds.

Description

(1) Technical field [0001] The present invention relates to an adenylation protein A6 mutant and its encoding gene, as well as its application as a key enzyme of adenylation domain in catalyzing the synthesis of polymyxin. (2) Background technology [0002] Paenibacillus polymyxa is a gram-positive bacterium, and its metabolite polymyxin, as the last line of defense against multidrug-resistant gram-negative bacteria, has great industrial value. In order to produce novel polymyxins with important biological activities, it is necessary to engineer the key enzymes involved in the synthesis of polymyxins, such as the key enzymes in the non-ribosomal polypeptide synthase (NRPS) that catalyzes the synthesis of polymyxins— - A domain (adenylation domain). [0003] NRPS linearly assembles amino acids in a modular manner, and according to their positions on the assembly line, different NRPS modules can be classified as initiating modules, extending modules, or termination modules. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C07K7/62C12P21/04C12R1/19
CPCC12N9/1085C12N15/70C07K7/62C12Y205/01Y02A50/30
Inventor吴杰群朱梅芳章旭红储消和
OwnerZHEJIANG UNIV OF TECH