Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for preparing bermuda grass protoplast by efficient separation

A technology for protoplasts and bermudagrass, which is applied in the field of high-efficiency separation and preparation of bermudagrass protoplasts, can solve the problems such as the separation method of bermudagrass protoplasts that is not described in detail, and achieves the effects of overcoming the small and difficult to operate, and the operation being simple and convenient.

Active Publication Date: 2021-09-24
YANGZHOU UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are only reports about the fusion of bermudagrass protoplasts and creeping bentgrass protoplasts (Liang Xuelian, Chen Ping, She Weibiao, Huang Hong. Research on the fusion of creeping bentgrass and bermudagrass protoplasts. Chinese Journal of Grassland, 2009, 31(04):63-68.), and the separation method for obtaining bermudagrass protoplasts is not described in detail

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing bermuda grass protoplast by efficient separation
  • Method for preparing bermuda grass protoplast by efficient separation
  • Method for preparing bermuda grass protoplast by efficient separation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Isolation and preparation of bermudagrass protoplasts.

[0036] 1. Tearing the bermudagrass leaves into strips: Use scissors to cut the young leaves from the normal growth and disease-free 'Yangjiang' bermudagrass plants, and wash the leaves with clean water to remove the attached dust and other impurities. After scraping off the lower epidermis of the leaves with a blade, use tweezers to tear the leaves into strips with a width of about 0.4-0.6mm. The fresh weight of the experimental materials is about 0.5g and placed in a petri dish.

[0037] 2. Add cellulase and isolated enzyme for vacuum filtration: add enzymatic hydrolysis buffer (20mM morpholineethanesulfonic acid, 0.52M mannitol, 20mM potassium chloride, 10mM calcium chloride, mass fraction 0.1% bovine Serum albumin, mass fraction 4% cellulase, mass fraction 0.8% dissociating enzyme, pH value 5.7) until the leaf strips are covered, after gently shaking the petri dish to wet the leaf strips, place the petri dish i...

Embodiment 2

[0050] Fusion Expression of TEOSINTE BRANCHED1(TB1) Gene and eGFP Gene in Protoplasts from Bermudagrass

[0051] 1. Cloning of TB1 gene from bermudagrass.

[0052] The total RNA of 'Yangjiang' bermudagrass leaves was extracted using the RNAprep Plant Total RNA Extraction Kit from Tiangen Biochemical Technology (Beijing) Co., Ltd., and the operation steps were carried out according to the instructions provided with the kit. Bermudagrass leaf RNA was reverse-transcribed into cDNA using the reverse transcription kit of Treasure Bio (Dalian) Co., Ltd., and the operation steps were carried out according to the instructions of the kit.

[0053] The primer TB1-F (sequence: TCTAGA ATGTTTCCTTTCTGTGATTC) and TB1-R (sequence: GGATCC GTAAAAACGTGAGTTGGCAAA), and the recognition base sequences TCTAGA and GGATCC of the restriction endonucleases XbaI and BamHI were added to the 5' ends of the upstream and downstream primers respectively.

[0054] Using the cDNA of bermudagrass leaves obt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing bermuda grass protoplast by efficient separation. The method comprises the following steps: (1) tearing bermuda grass leaves into strips; (2) adding cellulase and macerozyme to carry out vacuum filtration; (3) carrying out incubation and enzymolysis of the cellulase and the macerozyme to remove cell walls; (4) centrifugally collecting cells subjected to enzymolysis; (5) washing the cells to remove residual enzyme liquid; and (6) centrifuging again to obtain protoplast cells. According to the invention, as important warm-season turfgrass, the bermuda grass has the genetic characteristics of frequent outcrossing and complex ploidy, and is difficult for traditional cross breeding; and cell engineering breeding can overcome the dilemma and rapidly cultivate new varieties; and the method of preparing the bermuda grass protoplast, which is disclosed by the invention, can be used for efficiently preparing the bermuda grass protoplast, provides an important material for bermuda grass cell engineering breeding and molecular biology research based on cell fusion and gene transformation, and has great application value.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for efficiently separating and preparing bermudagrass protoplasts. Background technique [0002] Bermudagrass (Cynodon dactylon L.) is a herbaceous plant of the genus Bermudagrass in the Poaceae Teffae subfamily. It is an important warm-season turfgrass and forage grass. It has many advantages such as salinity and good palatability, and is widely used in the construction of lawns in sports fields, parks and green belts, as well as the establishment of grazing pastures on slopes and wastelands in southern China, and has important economic value. [0003] In addition to the above-mentioned excellent characteristics, Bermudagrass, as a wild grass species of Poaceae, also has the characteristics of frequent outcrossing and complex chromosomal ploidy. It is extremely difficult to breed new varieties of Bermudagrass using traditional hybrid breeding methods. The proto...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/04
CPCC12N5/04C12N5/0025
Inventor 张兵陈思徐鑫束方智
Owner YANGZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More