Method for preparing bermuda grass protoplast by efficient separation
A technology for protoplasts and bermudagrass, which is applied in the field of high-efficiency separation and preparation of bermudagrass protoplasts, can solve the problems such as the separation method of bermudagrass protoplasts that is not described in detail, and achieves the effects of overcoming the small and difficult to operate, and the operation being simple and convenient.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Isolation and preparation of bermudagrass protoplasts.
[0036] 1. Tearing the bermudagrass leaves into strips: Use scissors to cut the young leaves from the normal growth and disease-free 'Yangjiang' bermudagrass plants, and wash the leaves with clean water to remove the attached dust and other impurities. After scraping off the lower epidermis of the leaves with a blade, use tweezers to tear the leaves into strips with a width of about 0.4-0.6mm. The fresh weight of the experimental materials is about 0.5g and placed in a petri dish.
[0037] 2. Add cellulase and isolated enzyme for vacuum filtration: add enzymatic hydrolysis buffer (20mM morpholineethanesulfonic acid, 0.52M mannitol, 20mM potassium chloride, 10mM calcium chloride, mass fraction 0.1% bovine Serum albumin, mass fraction 4% cellulase, mass fraction 0.8% dissociating enzyme, pH value 5.7) until the leaf strips are covered, after gently shaking the petri dish to wet the leaf strips, place the petri dish i...
Embodiment 2
[0050] Fusion Expression of TEOSINTE BRANCHED1(TB1) Gene and eGFP Gene in Protoplasts from Bermudagrass
[0051] 1. Cloning of TB1 gene from bermudagrass.
[0052] The total RNA of 'Yangjiang' bermudagrass leaves was extracted using the RNAprep Plant Total RNA Extraction Kit from Tiangen Biochemical Technology (Beijing) Co., Ltd., and the operation steps were carried out according to the instructions provided with the kit. Bermudagrass leaf RNA was reverse-transcribed into cDNA using the reverse transcription kit of Treasure Bio (Dalian) Co., Ltd., and the operation steps were carried out according to the instructions of the kit.
[0053] The primer TB1-F (sequence: TCTAGA ATGTTTCCTTTCTGTGATTC) and TB1-R (sequence: GGATCC GTAAAAACGTGAGTTGGCAAA), and the recognition base sequences TCTAGA and GGATCC of the restriction endonucleases XbaI and BamHI were added to the 5' ends of the upstream and downstream primers respectively.
[0054] Using the cDNA of bermudagrass leaves obt...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



