Mutant of threonine aldolase and application thereof in preparation of substituted phenylserine derivatives

A threonine aldolase, mutant technology, applied in application, biochemical equipment and methods, introduction of foreign genetic material using vectors, etc. Acid aldolase has problems such as poor stability, and achieves excellent application prospects and good stability.

Active Publication Date: 2021-10-08
王喆明 +1
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the poor stability of threonine aldolase, the chiral selectivity, especially the insufficient chiral selectivity of β-hydroxyl, limits the application of this enzyme in chiral synthesis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant of threonine aldolase and application thereof in preparation of substituted phenylserine derivatives
  • Mutant of threonine aldolase and application thereof in preparation of substituted phenylserine derivatives
  • Mutant of threonine aldolase and application thereof in preparation of substituted phenylserine derivatives

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Amplification of threonine aldolase gene PSALD

[0027] According to the threonine aldolase gene information from Pseudomonas putida included in Genebank (the gene sequence is shown in SEQ ID NO: 1), the total genomic DNA of the thalline was extracted with a rapid nucleic acid extraction instrument, Using the genomic DNA as a template, PCR amplification was performed under the action of primer 1 (ATGAATGGTGAAA CCAGCCG) and primer 2 (TTAACGTTCCTGGGTGCGAT). PCR reaction system (total volume 50 μL): 5 μL of 10×Pfu DNA Polymerase Buffer, 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL of cloning primer 1 and primer 2 each at a concentration of 50 μM, 1 μL of genomic DNA, Pfu DNA Polymerase 1μL, nucleic acid-free water 40μL.

[0028] Using BioRad PCR instrument, PCR reaction conditions: pre-denaturation at 95°C for 5min, denaturation at 95°C for 30s, tempering at 65°C for 45s, extension at 72°C for 1min, a total of 30 cycles, and fina...

Embodiment 2

[0029] Example 2: Amplification of Threonine Aldolase Gene CCALD

[0030] According to the threonine aldolase gene information from Caulobacter crescentus included in Genebank (the gene sequence is shown in SEQ ID NO: 88), the total genomic DNA of the thalline was extracted with a rapid nucleic acid extraction instrument, Using the genomic DNA as a template, PCR amplification was performed under the action of primer 3 (ATGACCCAFACCGCGCCCCGCTA) and primer 4 (CTAAGCCACTCGCTTCAGCGCC). PCR reaction system (total volume 50 μL): 5 μL of 10×PfuDNA Polymerase Buffer, 1 μL of 10 mM dNTPmixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL of cloning primer 1 and primer 2 each at a concentration of 50 μM, 1 μL of genomic DNA, Pfu DNA Polymerase 1μL, nucleic acid-free water 40μL.

[0031] Using BioRad PCR instrument, PCR reaction conditions: pre-denaturation at 95°C for 5min, denaturation at 95°C for 30s, tempering at 65°C for 45s, extension at 72°C for 1min, a total of 30 cycles, a...

Embodiment 3

[0032] Embodiment 3: the construction of the recombinant escherichia coli of threonine aldolase gene PSALD

[0033] 1. Obtaining the recombinant plasmid pET28a-PSALD

[0034] Obtain the PSALD gene sequence, use Nde I and Xho I restriction endonuclease (TaKaRa) to process the amplified fragment after sequencing, and use T 4 DNA ligase (TaKaRa) ligated the fragment with the commercialized vector pET28a treated with the same restriction endonuclease to construct the expression vector pET28a-PSALD.

[0035] 2. Transformation of Escherichia coli E.coli BL21(DE3) with recombinant plasmid

[0036]Add 10 μL of PCR product to 100 μL E.coli BL21 (DE3) competent cell suspension in each tube, mix gently, and let stand in ice bath for 30 min. Transfer to a 42°C water bath and heat shock for 90s. Quickly transfer to an ice bath to cool for 3 min. Add 700 μL LB liquid medium to each tube, and incubate at 37° C. for 1 hour on a shaker at 100 rpm. After culturing, the bacterial solution w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mutant of threonine aldolase, a coding gene of the mutant, a recombinant vector constructed by the coding gene, a recombinant genetic engineering bacterium obtained by converting the recombinant vector, and application of the mutant of the threonine aldolase in preparation of 2- / 3- / 4-substituted phenylserine derivatives. According to the invention, the mutant of the threonine aldolase is taken as a biocatalyst, 2- / 3- / 4-substituted benzaldehyde is taken as a substrate, 5-phosphopyridoxal is taken as a coenzyme, glycine / glycine ester is taken as a cosubstrate, the enzyme catalysis reaction is performed under proper conditions and in a proper medium, a series of phenylserine derivatives with different substituent groups are prepared through separation, and the method has the total yield range of 76-99%, the product ee value of over 99%, and the de value range of 71-92%.

Description

[0001] This application is a divisional application with application number 201811310893.4, application date November 6, 2018, and invention title "threonine aldolase, mutants and their application in the preparation of substituted phenylserine derivatives". technical field [0002] The invention relates to the field of biotechnology, in particular to a threonine aldolase mutant and its application in the preparation of 2- / 3- / 4-position substituted phenylserine derivatives. Background technique [0003] 2- / 3- / 4-substituted phenylserine derivatives are important pharmaceutical intermediates and chemical intermediates, especially 4-thiamphenicol phenylserine, which are widely used in the preparation of human antibiotics, poultry and livestock antibiotics, etc. , which represent drugs such as chloramphenicol, thiamphenicol, florfenicol and so on. [0004] The synthesis methods of 2- / 3- / 4-position substituted phenylserine derivatives mainly include chemical synthesis and enzyme ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N15/75C12N15/81C12N1/21C12N1/19C12P13/00
CPCC12N9/88C12N15/70C12N15/75C12N15/81C12P13/00C12Y401/02005C12Y401/02042
Inventor王喆明张荣珍谭昊李利宏
Owner王喆明