miRNA molecule related to pig antral follicle atresia and application of miRNA molecule
A follicular atresia and molecular technology, applied in the field of miRNA and its application, can solve the problem of low ovulation rate and achieve the effect of promoting apoptosis of granulosa cells, strong specificity, and short sequence
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Expression difference of porcine miR-9820-5p in healthy and atretic antral follicles
[0045] (1) Design of porcine miR-9820-5p primers
[0046] According to the sequence of sus-miR-9820-5p (NR_128505.1), primers were designed; the specific sequence is as follows:
[0047] Reverse transcription primer SEQ ID No.2: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGCCTTTC;
[0048] The specific forward primer sequence of miR-9820-5p is SEQ ID No.3: GCCGAGGAGGAGGAGGGAA;
[0049] The forward primer sequence of U6 is SEQ ID No.8: CGCTTCGGCAGCACATATAC;
[0050] U6 reverse primer sequence SEQ ID No.9: TTCACGAATTTGCGTGTCAT;
[0051] The reverse universal primer sequence SEQ ID No.10 for miRNA amplification: CTCAACTGGTGTCGTGGA;
[0052] The above primers were synthesized by a primer synthesis company, wherein U6 is an internal reference gene.
[0053] (2) RNA extraction of pig healthy antral follicles (conventional TRIZOL method):
[0054] Healthy pre-estrus pig ovaries were taken, an...
Embodiment 2
[0062] Cellular localization of porcine miR-9820-5p
[0063] (1) Design of porcine miR-9820-5p fluorescent probe
[0064] According to the principle of complementary pairing, a digoxigenin-labeled probe for miR-9820-5p was designed. The sequence of the probe is shown in SEQ ID NO:4. The probe was synthesized by Probe Synthesis Company.
[0065] (2) Scale culture of porcine granulosa cells
[0066] Pig ovaries were washed with sterile saline containing gentamicin (80 mg / L), and follicular fluid and granulosa cells were extracted from transparent antral follicles with a diameter of about 5 mm using a syringe with a 20-gauge needle. Then culture porcine granule cells in DMEM / F12 medium (purchased from Gibco, USA) containing 10% fetal bovine serum (FBS), 100 units / mL penicillin and 100 mg / mL streptomycin, and the cells were seeded on coverslips. In a six-well plate, the incubator conditions were 37 °C and 5% CO2. After the cells adhere to the wall, the coverslip can be remove...
Embodiment 3
[0073] miR-9820-5p promotes apoptosis of porcine granulosa cells
[0074] (1) Design of miR-9820-5p-specific mimics and inhibitors
[0075] Using the miR-9820-5p sequence as a template, it was synthesized by a synthetic company. The sequence pairs of miR-9820-5p-specific mimics are respectively SEQ ID NO:5 and SEQ ID NO:6; the sequences of miR-9820-5p-specific inhibiror are respectively SEQ ID NO:7.
[0076] (2) Transfection of porcine granulosa cells miR-9820-5p
[0077] Porcine granulosa cells were cultured for 36 hours and transfected when the cells reached 50-80% confluency. LipofectamineTM3000 transfection reagent and Opti MEM medium (purchased from Invitrogen) were used for transfection according to the instruction manual. Experiments were performed in three biological replicates.
[0078] (3) Detection of miR-9820-5p specific mimics and inhibitory efficiency
[0079] Using porcine granulosa cell cDNA transfected with miR-9820-5p-specific mimics, miR-9820-5p-specifi...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



