Application of OsPARP3 gene in regulation and control of plant drought tolerance
A drought tolerance, gene technology, applied in application, plant products, genetic engineering and other directions, to reduce labor force, improve drought stress tolerance of rice, and have broad application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1: Identification of T-DNA insertion mutants
[0028] The present invention is based on a T-DNA insertion mutant of rice (Oryza sativa L.ssp. Japonica cv.Donjin) with reduced drought tolerance, and uses specific primers to perform PCR amplification to verify the insertion position and the specific gene of the insertion mutant. Because of a gene number Os02g0530600, OsPARP3 gene encoding PARP protein. In the present invention, homozygous T-DNA insertion mutant rice is obtained by identifying and isolating, and the expression loss of OsPARP3 in the mutant is further verified by western-blot.
[0029] The obtained T-DNA mutant rice was planted, and the leaves were sampled from individual plants, and the genomic DNA of the mutant leaves was extracted, amplified and sequenced through the border sequence primers of the T-DNA vector and the OsPARP3 gene flanking sequence primers. Using primers LP and RP, the genome sequence can be amplified, and primers RB1 and LP ...
Embodiment 2
[0030]Embodiment 2: Cloning of OsPARP3 gene and construction of overexpressed plants
[0031] 1. Take the model rice material Nipponbare (Oryza sativa L.ssp.Japonica cv.Nipponbare) seeds, and perform RNA extraction according to the instructions of Biotec Polysaccharide Polyphenol RNA Plant Extraction Kit (containing DNase); use agarose gel electrophoresis and nanodrop The purity and concentration of the total RNA was detected by a micro-spectrophotometer, and 1 μg of total RNA was used for the initial reverse transcription reaction. The reverse transcriptase used was PrimeScript, and the steps of the reverse transcription reaction were referred to the instructions for use of the reverse transcriptase. Using the reverse transcription product as a template, primers F: ATGGTACACGAGACAAGATCACG; R: TCACTCGTCCGGCACCAC were used for PCR amplification, and the polymerase used in PCR was KOD FX (Toyobo). The reaction system is 50uL, and the PCR reaction system is prepared according to ...
Embodiment 3
[0034] Example 3: Functional identification of OsPARP3 gene
[0035] 1. Expression of OsPARP3 at mRNA level in rice after ABA and drought treatment
[0036] The roots of Nipponbare 3-leaf stage seedlings were respectively immersed in rice culture solution containing 5 μM ABA and 20% PEG6000 for treatment, and materials with different treatment time lengths of 0, 1, 3, 6, 12, and 24 hours were taken. The stem, leaf and root total RNA was extracted with TriZol Reagent. For the detection method, refer to step 3 of Example 2. The result is as Figure 4 As shown, under the conditions of ABA and drought treatment (PEG6000 treatment), the OsPARP3 gene in shoots, leaves and roots was induced and up-regulated, indicating that OsPARP3 gene responds to ABA and drought.
[0037] 2. Drought treatment of OsPARP3 overexpression transgenic lines and mutants
[0038] The harvested OsPARP3 homozygous overexpression lines, homozygous mutant osparp3 lines, wild-type DJ, and wild-type Nipponbar...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More