Talaromyces marneffei mannan protein and application of talaromyces marneffei mannan protein in preparation of talaromyces marneffei antibody detection kit
A mannan and marneffei technology, applied in the field of Talaromyces marneffei detection, can solve the problems of poor repeatability, low efficiency, and lack of conditions for highly specific markers, and achieves a simple method, good repeatability, The effect of high protein expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1 Get a Malni Philippine Bulphae Gannitan Protein
[0053] (1) primer design
[0054] According to the base composition of the target sequence, the primer amplification target gene is designed, respectively, and the inverse direction contains ECOR I and XHO I-enzymes. The primer sequence is as follows:
[0055] Positive primers: 5 'ccatgcaccaccaccacccaccaccaaagttaaacgtgaag 3' (Ecor i);
[0056] Reverse primers: 5 'AAGCTTTCATTAGAACGCATCAATACCCTTC 3' (Xho I);
[0057] (2) Genetic amplification
[0058] Conventional SDS alkali cracking method breaks the Malni Philippine lunar cell wall, using a DNA extraction kit, according to the instructions, and the total DNA is obtained, and the target gene is expanded as a template.
[0059] PCR reaction system:
[0060] Fastpfu 10 * Buffer: 5.0 μL;
[0061] DNTP MINTURE: 5.0 μL;
[0062] Positive primer: 2.0 μL;
[0063] Reverse primers: 2.0 μL;
[0064] DNA Template: 3.0 μL;
[0065] Fastpfu DNA polymerase: 1.0 μL;
[0066] DDH ...
Embodiment 2
[0088] Mannan protein prepared article, test strip, in Example 1 of a fluorescent pad, a fluorescent microsphere labeled, and the detection line package was prepared by the description obtained by the description of the mannose protein, sandwich. Method detects the Malni Philippine Bulmon Bacillus antibody in human serum samples.
[0089] 1, test paper strip preparation process
specific Embodiment
[0090] Fluorescence Microsphere Surface Mark Example 1 The obtained mannan protein was prepared. Specifically, the implementation, for example:
[0091] 1 ml 1% carboxy fluorescent microspheres were added to a 9 mL MES buffer, and then 400 μl of EDC solution (10 mg / mL) and 400 μl of NHS solution (10 mg / ml) were added, and the room temperature was oscillated for 30 min, and the precipitate was collected from centrifugation. The hepes reconstition was added, and 1 ml of 1 mg / ml of mannan protein and 1 ml of 1 mg / ml of gulc glycan and 1 ml of 1 mg / ml of gulc glycanin were added and 1 ml of 1 mg / ml of chicken IGY were added, and then 1 ml of blocking liquid (10% BSA) was added. 120 min. The microspheres were collected by centrifugation, and the recovery was reconstituted.
[0092] Fluorescent pads Buried fluorescent microspheres: The labeled fluorescent microspheres are diluted with a microsphere reconstall solution, and the fluorescent pad is sprayed using a gaminergic, s...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com