Unlock instant, AI-driven research and patent intelligence for your innovation.

Talaromyces marneffei mannan protein and application of talaromyces marneffei mannan protein in preparation of talaromyces marneffei antibody detection kit

A mannan and marneffei technology, applied in the field of Talaromyces marneffei detection, can solve the problems of poor repeatability, low efficiency, and lack of conditions for highly specific markers, and achieves a simple method, good repeatability, The effect of high protein expression

Active Publication Date: 2022-03-01
DYNAMIKER BIOTECH TIANJIN
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is greatly affected by the use of medium, pH and temperature control, etc., and can only extract protein in small doses, with low efficiency and poor repeatability, and the extract will contain a variety of proteins, and does not have the conditions for high specificity markers , so it is not suitable for serological immunodiagnosis of Tamarneffei disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Talaromyces marneffei mannan protein and application of talaromyces marneffei mannan protein in preparation of talaromyces marneffei antibody detection kit
  • Talaromyces marneffei mannan protein and application of talaromyces marneffei mannan protein in preparation of talaromyces marneffei antibody detection kit
  • Talaromyces marneffei mannan protein and application of talaromyces marneffei mannan protein in preparation of talaromyces marneffei antibody detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Get a Malni Philippine Bulphae Gannitan Protein

[0053] (1) primer design

[0054] According to the base composition of the target sequence, the primer amplification target gene is designed, respectively, and the inverse direction contains ECOR I and XHO I-enzymes. The primer sequence is as follows:

[0055] Positive primers: 5 'ccatgcaccaccaccacccaccaccaaagttaaacgtgaag 3' (Ecor i);

[0056] Reverse primers: 5 'AAGCTTTCATTAGAACGCATCAATACCCTTC 3' (Xho I);

[0057] (2) Genetic amplification

[0058] Conventional SDS alkali cracking method breaks the Malni Philippine lunar cell wall, using a DNA extraction kit, according to the instructions, and the total DNA is obtained, and the target gene is expanded as a template.

[0059] PCR reaction system:

[0060] Fastpfu 10 * Buffer: 5.0 μL;

[0061] DNTP MINTURE: 5.0 μL;

[0062] Positive primer: 2.0 μL;

[0063] Reverse primers: 2.0 μL;

[0064] DNA Template: 3.0 μL;

[0065] Fastpfu DNA polymerase: 1.0 μL;

[0066] DDH ...

Embodiment 2

[0088] Mannan protein prepared article, test strip, in Example 1 of a fluorescent pad, a fluorescent microsphere labeled, and the detection line package was prepared by the description obtained by the description of the mannose protein, sandwich. Method detects the Malni Philippine Bulmon Bacillus antibody in human serum samples.

[0089] 1, test paper strip preparation process

specific Embodiment

[0090] Fluorescence Microsphere Surface Mark Example 1 The obtained mannan protein was prepared. Specifically, the implementation, for example:

[0091] 1 ml 1% carboxy fluorescent microspheres were added to a 9 mL MES buffer, and then 400 μl of EDC solution (10 mg / mL) and 400 μl of NHS solution (10 mg / ml) were added, and the room temperature was oscillated for 30 min, and the precipitate was collected from centrifugation. The hepes reconstition was added, and 1 ml of 1 mg / ml of mannan protein and 1 ml of 1 mg / ml of gulc glycan and 1 ml of 1 mg / ml of gulc glycanin were added and 1 ml of 1 mg / ml of chicken IGY were added, and then 1 ml of blocking liquid (10% BSA) was added. 120 min. The microspheres were collected by centrifugation, and the recovery was reconstituted.

[0092] Fluorescent pads Buried fluorescent microspheres: The labeled fluorescent microspheres are diluted with a microsphere reconstall solution, and the fluorescent pad is sprayed using a gaminergic, s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a talaromyces marneffei mannan protein and application of the talaromyces marneffei mannan protein in preparation of a talaromyces marneffei antibody detection kit. The amino acid sequence of the mannan protein is as shown in SEQ ID No.1. The invention further provides a preparation method of the talaromyces marneffei mannan protein. The mannan protein can be combined with a talaromyces marneffei antibody and has good sensitivity and specificity, the sensitivity reaches 85.1%, and the specificity reaches 100%.

Description

Technical field [0001] The present invention has created a field of detection of Malni Philippine baskets, in particular, involving a Malni-Philippine genus mannan protein and its application in the preparation of Malni Philippine baskets antibody detection kits. Background technique [0002] Malni Philippine basket Talomyces Marneffei ) Formerly known as Malnikidiofin ( Penicillium Marneffei ) It is the only two-phase greens that can cause human pathogenic, infected people in the host. At 30 ° C, Malny Philippine Bulk is presented in a mycelial state, and at 37 ° C is a yeast state. The former can form a red pigment in the medium, and the latter is not. Only yeast types are pathogenic. In addition, Malni-Philippine fever is transitioned between the two times, and it is easier to change from the yeast type to mycelial shape. It takes only 1 to 2 days to grow out and produce red pigment; The latter transitions to the former more than 3 weeks, will pass a short rod-shaped or malfo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/385C07K1/22C12N15/70C12N15/31
CPCC07K14/385C12N15/70G01N33/56961G01N33/558G01N2469/20G01N2333/385
Inventor 杨光彭洁严俊盛长忠粟艳周泽奇
Owner DYNAMIKER BIOTECH TIANJIN
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More