Tobacco xyloglucan xylosyltransferase gene and application of tobacco xyloglucan xylosyltransferase gene in regulation of arsenic adsorption and transportation
A technology of xylosyltransferase and xyloglucan, applied in the field of tobacco xyloglucan xylosyltransferase gene and its application in regulating arsenic adsorption and transport, can solve unclear problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Identification and Phylogenetic Tree Analysis of NtXXTs
[0042] Using the protein sequence of Arabidopsis thaliana AtXXT1-5 downloaded from TAIR (www.arabidopsis.org), XXT orthologs in tobacco were identified and used as the International Tomato Genome Database (https: / / solgenomics.net / organism / Solanum_lycopersicum / genome). The protein sequences of AtXXTs and NtXXTs were compared with ClustalW2 (http: / / www.ebi.ac.uk / Tools / msa / clustalw2 / ) software. Remove redundant repeats in NtXXTs. A Poisson model method was used to analyze the development of phylogenetic trees using the neighborhood connection method of MEGA6.0. The temporal and spatial expression patterns of NtXXTs were detected by semi-quantitative PCR. Various tissues (young leaves, mature leaves, senescent leaves, stems, roots, veins and flowers) were collected during the tobacco growing season. Each tissue had 3 independent biological replicates, frozen in liquid nitrogen and stored in a -80°C freezer. For...
Embodiment 2
[0045] Enter the CDS sequences of Ntab-K326_AWOJ-SS412 (NtXXT1) and Ntab-K326_AWOJ-SS848 (NtXXT2) on the CRISPR MultiTargeter (http: / / www.multicrispr.net / ) tool design website, such as SEQ ID NO.1 and SEQ ID NO As shown in .2, sgRNA sequences with different scores can be obtained, and sgRNA sequences with fewer homologous genes and as high a score as possible are selected as target sequences. Selected sgRNATarget1:GATTTTGCTTTTCACATCCTG (SEQ ID NO.3), Target 2:TCTTATTGAGGAATACTCAA (SEQ ID NO.4), and Target3:CTTATTGAGGAATACTCAAT (SEQ ID NO.5) as the target sequence of NtXXT1; sgRNA Target 1:TATCAGATTGGGATGAGCAG (SEQ ID NO. ID NO.6), Target 2: ATCAGATTGGGATGAGCAGA (SEQ ID NO.7) and Target 3: GGGATGAGCAGAGGGCTGAG (SEQ ID NO.8) as the target sequence of NtXXT2, and then synthesize corresponding forward and reverse complementary sgRNADNA oligonucleotides Acids, which form dimers by annealing. Then, the annealed product was connected to the modified CRISPR-Cas9 pORE O4 vector plasmi...
Embodiment 3
[0050] In order to determine whether xyloglucan is lacking in ntxxt1 / 2, the following test was performed: the leaves of 6-week-old tobacco plant K326 and the tobacco plants ntxxxt1, ntxxt2 and ntxxt1 / 2 obtained in Example 2 were collected, frozen with liquid nitrogen and ground into powder , These materials were prepared as ethanol insoluble matter (AIR), and the process of extracting AIR was as follows: the ground powder was sequentially extracted with 70% and 80% ethanol water for 30 minutes, then extracted with absolute ethanol, filtered through Whatmans filter paper and suspended in acetone residue and blow dry in a fume hood. Then α-amylase and amyloglucosidase were used to remove the starch in AIR in a water bath at 37°C overnight, and AIR (2mg)) was hydrolyzed with 2M trifluoroacetic acid (TFA) at 120°C for 2h, followed by 1-phenyl- 3-Methyl-5-pyrazolone (PMP) was reacted at 70°C for 30 minutes, the mixture was extracted three times with chloroform, and the PMP-monosacc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More