STAT2 gene deletion cell strain as well as preparation method and application thereof

A gene deletion and cell line technology, applied in the fields of molecular biology and genetics, can solve the problems of host cell tumorigenic risk, low efficiency of packaging virus, low efficiency of toxin production, etc., and achieve high knockout efficiency and strong reproducibility , the effect of reducing production costs

Pending Publication Date: 2022-04-15
北京镁伽科技有限公司
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a STAT2 gene-deficient cell line, a construction method, an application, and a method for packaging a virus in order to overcome the problems in the prior art such as low efficiency of toxin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • STAT2 gene deletion cell strain as well as preparation method and application thereof
  • STAT2 gene deletion cell strain as well as preparation method and application thereof
  • STAT2 gene deletion cell strain as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0092] The preparation method of the linear PUC-sgRNA plasmid is as follows: the PUC-sgRNA plasmid is digested with BbsI.

[0093] The transformation and identification of sgRNA1 expression vector and sgRNA2 expression vector were carried out according to the following methods:

[0094] (1) bacterial transformation

[0095] Preparation (~30min in advance): Take out the competent cells Trans-T1 (purchased from Quanshijin) stored in the EP tube from the -80°C refrigerator (100 μL per tube), and thaw on ice (about 15min) Then, divide half (50 μL) of each tube into a new EP tube; open two water baths at 42°C and 37°C; take the resistant (Amp+) LB solid medium and put it into a 37°C incubator to preheat.

[0096] Each tube of competent cells Trans-T1 (50 μL) was operated as follows: add 10 μL of plasmid (ie sgRNA1 expression vector or sgRNA2 expression vector or reporter vector), put it on ice for 10 min, put it in a 42 ℃ water bath, heat shock for 40 s, Quickly transfer to ice f...

Example Embodiment

[0101] Example 1

[0102] This example is used to illustrate the STAT2 gene deletion cell line and its construction

[0103] (1) STAT2 gene primer design

[0104] The primers in Table 1 were designed according to the STAT2 gene of HEK293 cells (STAT2 genome sequence NCBI ID: U18671.1), and the primers were validated by PCR (683bp) (eg figure 1 shown).

[0105] Table 1

[0106] Upstream primer: SEQ ID NO.: 1 (5'-3') TTGGGAACCCTCATCCTTCT Downstream primer: SEQ ID NO.: 2 (5'-3') CTTTGTCTTTTCACCATAGC

[0107] (2) Construction of sgRNA1 expression vector and sgRNA2 expression vector

[0108] (a) sgRNA primers annealing (sgRNA primers annealling)

[0109] Two sgRNA targets were designed according to the STAT2 genome sequence, namely the sgRNA1 target sequence (SEQ ID NO.: 3, GGAGGCTGTGCGAGTAAAGCTGG) and the sgRNA2 target sequence ((SEQ ID NO.: 4, GATCAGCTGAACTATGAGTGTGG). One pair was synthesized according to the designed target sequence. Primers (as sho...

Example Embodiment

[0158] Example 2

[0159] This example is used to illustrate the use of the HEK293 cell line with the deletion of the STAT2 gene for virus packaging and effect verification.

[0160] (1) Lentiviral packaging

[0161] The STAT2 gene-deficient HEK293 cells of the present invention were inoculated into 6-well plates for culture as experimental group 1, while 293T cells (purchased from the Cell Bank of Chinese Academy of Medical Sciences, GNHu17) were inoculated into 6-well plates as experimental group 2 for comparison. Wild-type HEK293 cells were seeded into 6-well plates for culture as experimental group 3. Three groups of cells were plated at the same cell density 24 hours before transfection (1x10 6 Cells / well), when the cell density of the 3 groups reached about 80% confluence, the lentiviral plasmid packaging was verified. The commercially available lentiviral packaging plasmid system (main plasmid PLVX-mCherry-C1, auxiliary plasmids PLP1, PLP2, PLP-VSVG, were purchased f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of biology and genetics, and discloses an STAT2 gene deletion cell strain as well as a preparation method and application thereof. The stable cell strain is established by selecting the HEK293 cell, and has the advantages of high virus yield and no tumorigenicity, the virus production and preparation time is saved, the virus recovery efficiency is improved, and the production cost is reduced. The CRISPR/Cas9 technology is utilized to perform specific targeted knockout on the STAT2 gene of the cell to obtain the STAT2 gene deleted cell strain, the method is simple, the replicability is strong, the knockout efficiency is extremely high, and in a preferred implementation scheme, by utilizing a gene knockout system containing a reporter vector, target cells can be quickly and intuitively screened.

Description

technical field [0001] The invention relates to the technical fields of molecular biology and genetics, in particular to a STAT2 gene deletion cell line and its preparation method and application. Background technique [0002] CRISPR-Cas9 is an adaptive immune defense formed during the long-term evolution of bacteria and archaea, which can be used to fight against invading viruses and foreign DNA. The CRISPR-Cas9 gene editing technology is a technology for specific DNA modification of targeted genes, and this technology is also a cutting-edge method for gene editing. The principle and core key technology of the present invention is that a Cas9 nuclease can recognize and cut target double-stranded DNA by using a guide RNA (gRNA). Due to many advantages such as high mutation efficiency, low cost, and wide application range, this technology is one of the most promising gene therapy technologies for clinical and application. [0003] Virus packaging is the process of using tra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N5/10C12N15/85C12N15/65C12N9/22C12N15/113C12N15/867C12N7/00C12R1/93
Inventor 许傲天白晓张起起
Owner 北京镁伽科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap