Sorghum disease-resistant gene and application thereof
A disease-resistance gene and sorghum technology, applied in sorghum disease-resistance gene and its application field, can solve the problem that the disease-resistance immune mechanism of sorghum cannot be known, and achieve the effects of improving disease resistance and reducing disease
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Taking the total RNA of leaves of sorghum immunized variety SAP35 as the template to synthesize the first strand of cDNA by reverse transcription, using homologous cloning technology, the primers were designed according to the genome sequence of common sorghum variety BTx623, and the SbRLK1 gene sequence was amplified by amplification. The open reading frame is 2748bp in full length, and the sequence is shown in SEQ ID NO.1. It encodes a protein with 916 amino acids, the sequence of which is shown in SEQ ID NO.2.
[0038] Construction of overexpression vector: extract sorghum RNA and reverse-transcribe cDNA; use cDNA as a template to amplify the SbRLK1 gene using the following primers. The primer sequences are as follows:
[0039] Upstream primer: SbRLK1-F:GC GAATTCATGGCCGCGTCGGATCT;
[0040] Downstream primer: SbRLK1-R:CG CTCGAGTTAGTATTCCCACTTCTTGAGCT.
[0041] The SbRLK1 amplification product was inserted into the downstream of the Ubi promoter and the upstream of t...
Embodiment 2
[0043] The resistance of SbRLK1 transgenic sorghum plants to pathogen invasion at seedling stage was identified by staining the growth cones of sorghum seedlings. In order to observe the resistance of transgenic sorghum to head smut during early germination, transgenic sorghum T 1 Generation and non-transgenic control wild-type WT sorghum (Tx430) were sown in plug trays, and the seeds were covered with fungus soil with a thickness of at least 2 cm. ℃ fermentation for 3 days. The plugs were placed at 26°C to 28°C for about 40 days. The leaves of sorghum were collected, quick-frozen in liquid nitrogen and stored at -80°C for genomic DNA extraction and RNA extraction. Strip the corresponding numbered sorghum growth cones and add aniline blue dye solution, dye in boiling water bath for 15-20min, rinse with running water, observe the dyeing situation of the growth cones with a microscope, and count the results, see the results. figure 1 . After aniline blue staining (coloring o...
Embodiment 3
[0046] Detection of SbRLK1 gene expression in transgenic plants. For the extraction of sorghum and rice RNA, the polysaccharide and polyphenol plant RNA extraction kit (spin column type) of Tiangen Biotechnology Company was used to extract the total RNA of sorghum and rice. The extraction steps were performed according to the kit instructions. The cDNA synthesis was performed according to the instructions of the cDNA first-strand synthesis kit (TaKaRa). According to the SbRLK1 gene sequence and the principle of real-time quantitative PCR primer design, Primer 6.0 software was used for primer design, which was synthesized by Shanghai Jierui Bioengineering Co., Ltd. The amplification reaction procedure adopts a three-step method: 95°C for 5 min, and PCR for 45 cycles. Denature at 95°C, anneal at 58°C, and extend at 72°C. The instrument detects the PCR amplification products. The temperature rises from 65 °C to 95 °C until all the PCR products are dissolved. The temperature ris...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More