Nucleic acid aptamer for specifically recognizing soybean antigen beta-conglycinin

A technology of conglycinin and nucleic acid aptamer, which can be used in DNA/RNA fragments, material testing products, biological testing, etc., and can solve the problems of long time consumption, unsuitable for application, and unsuitable for large-scale testing.

Pending Publication Date: 2022-07-01
WILMAR SHANGHAI BIOTECH RES & DEV CENT
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the SDS-PAGE method can only be used for qualitative analysis, and the results are not easy to repeat; the detection method of Western blot has certain accuracy, but it takes a long time in the test process, and the test cost is relatively high, so in some routine Production testing is limited; high performance liquid chromatography is time-consuming and the instrument is relatively expensive, which is not suitable for actual production applications
The enzyme-linked immunosorbent assay (ELISA) can be used for qualitative or quantitative analysis, and has been widely recognized for its advantages of simple operation, rapidity, and suitability for batch testing. However, this method has unavoidable disadvantages: the preparation of antibody serum is complicated, Can not be compared between different laboratories, low sensitivity and accuracy
Therefore, the above methods all have certain high efficiency and sensitivity, but each has obvious disadvantages, especially high cost and long time consumption, and is not suitable for rapid analysis of a large number of samples in production, and is not suitable for mass detection in the food and feed industry.
[0005] Hongmin Jia et al. used high performance liquid chromatography to analyze the content of the antigenic epitope Glym 5.0101 in soybean β-conglycinin. Although it has the characteristics of high accuracy and batch detection, it takes too long in actual use and the instrument Relatively expensive, not suitable for practical operation
[0006] Patent CN 104897902 A etc. adopt the indirect Elisa method of polyclonal antibody serum to analyze the content of soybean β-conglycinin. At the same time, the method has unavoidable shortcomings: antibody serum needs to be prepared repeatedly, cannot be compared between different laboratories, and has low sensitivity and accuracy.
It is mentioned that the content of β-conglycinin subunit varies the most, and the ELISA detection method established by the monoclonal antibody prepared against the antigenic site of the subunit may have a large discrepancy with the theoretical value.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer for specifically recognizing soybean antigen beta-conglycinin
  • Nucleic acid aptamer for specifically recognizing soybean antigen beta-conglycinin
  • Nucleic acid aptamer for specifically recognizing soybean antigen beta-conglycinin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0080] Example 1: Artificial synthesis to obtain specific nucleic acid aptamer Apt1

[0081] Entrusted Shanghai Sangon Bioengineering Co., Ltd. to synthesize the specific nucleic acid aptamer Apt1 of β-conglycinin and its complementary sequence, wherein the sequence of Apt1 is as follows:

[0082] AACACGACGGCCCTGTGTCCATCACAGTGTTGTGCATGTGGGC (SEQ ID NO: 1).

Embodiment 2

[0083] Example 2: Establishment of a fluorescent sensor method for the detection of β-conglycinin by Apt1 aptamer

[0084] 1) Construction of aptamer fluorescence system

[0085] First buffered with Tris HCl (50 mM Tris-HCl, 100 mM NaCl, 10 mM MgCl 2 , pH7.5) dilute Apt 1 aptamer and corresponding complementary sequence to a concentration of 10 μM, then add 50 μL of 10 μM Apt 1 aptamer and 50 μL of 10 μM complementary sequence cDNAs to a 1.5 mL centrifuge tube, vortex After rotating and oscillating evenly, put it in a water bath, and heat it at 95 °C for 10 min to release its own spiral. Finally, the nucleic acid mixture to be heated was cooled to room temperature for renaturation, and diluted 100 times with double distilled water to obtain 50 nM double-stranded DNA (dsDNA) synthesized by Apt1 aptamer and its complementary sequence, which was stored in a refrigerator at 4°C overnight for ready for use.

[0086] 2) Establishment of fluorescence detection method

[0087] 15 ...

Embodiment 3

[0096] Example 3: Detection of β-conglycinin in fermented soybean meal products with higher drying temperature

[0097] Sample 1, sample 2 and sample 3 are all fermented soybean meal products in the domestic market, and unfermented soybean meal is used as a control. The β-conglycinin content of the samples was detected by electrophoresis method, aptamer Apt1 method and antibody method (commercially available Elisa kit) respectively, and the test results of soybean meal were used as the standard 100%, and other test results were divided by the results of soybean meal. Degradation ratio value of β-conglycinin. in,

[0098] The electrophoresis method process is as follows: take 3 grams of the crushed sample with a size of 60 mesh in a triangular flask, add an appropriate amount of sample extract, mix well, then shake at 37°C for 2 hours, centrifuge at 10,000 rpm for 10 minutes, and take the supernatant. Add the loading buffer, take a boiling water bath for 5 minutes, and perfor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a nucleic acid aptamer for identifying soybean antigen beta-conglycinin. The aptamer has a nucleotide sequence shown as SEQ ID NO: 1. The nucleic acid aptamer disclosed by the invention not only has better sensitivity and specificity, but also greatly improves the detection efficiency of the soybean antigen beta-conglycinin and reduces the detection cost, so that the method is suitable for batch detection of soybean antigen proteins in soybeans and deeply processed products thereof in food and feed industries.

Description

technical field [0001] The present invention relates to a nucleic acid aptamer, in particular to a nucleic acid aptamer for specifically recognizing soybean antigen β-conglycinin. Background technique [0002] The protein content of soybean seeds is very high, generally about 38% for cultivars, and up to about 50% for wild soybeans and semi-wild soybeans. From the analysis of amino acid composition and essential amino acid content, soybean protein is one of the few nutritional products that can replace animal protein. However, soybean contains a variety of anti-nutritional factors such as trypsin inhibitor, lectin, isoflavone, soybean antigen and so on. Among them, soybean antigens refer to a class of proteins in soybeans that can cause allergic reactions in humans and young animals, which hinders the wide application of soybean proteins in the food and feed industries. In particular, young animals such as piglets and calves in livestock and poultry production are prone to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/115G01N33/68
CPCC12N15/115G01N33/68C12N2310/16
Inventor宋鹏马立周邓禹
OwnerWILMAR SHANGHAI BIOTECH RES & DEV CENT