Recombinant yeast engineering strain for producing 7-dehydrocholesterol and application

A technology of dehydrocholesterol and engineering bacteria, applied in the field of genetic engineering and bioengineering, can solve the problems of high price and low productivity

Pending Publication Date: 2022-07-05
HUNAN NORCHEM PHARMACEUTICAL CO LTD
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the prices of 25-hydroxyvitamin D3 and 25-hydroxy-7-dehydrocholesterol at home and abroad are still expensive and the productivity is low. The production of drugs such as -7-dehydrocholesterol is of great significance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant yeast engineering strain for producing 7-dehydrocholesterol and application
  • Recombinant yeast engineering strain for producing 7-dehydrocholesterol and application
  • Recombinant yeast engineering strain for producing 7-dehydrocholesterol and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Construction of a recombinant Saccharomyces cerevisiae strain producing 7-dehydrocholesterol

[0053] Select ERG5 and ERG6 of Saccharomyces cerevisiae CENPK2-1D as the integration site of δ(24)-sterol reductase gene DHCR24, and use primers TEF1p-F / TEF1p-R to amplify promoter P TEF1 , the primer TEF1t-F / TEF1t-R amplifies the terminator T TEF1 , using primers DHCR24-F / DHCR24-R to amplify the gene DHCR24 shown in SEQ ID NO.1, using primers ERG5 / 6-armup-F / ERG5 / 6-armup-R and ERG5 / 6-armdown-F / ERG5 / 6-armdown-R to amplify the upstream and downstream homology arms of ERG5 / 6 sites respectively, and use fusion PCR to connect the homology arms and DHCR24 gene into a fragment named DHCR24-1. Using primers 4-1-ERG5-PAM-1-F / 4-1-ERG5-PAM-1-R, 4-2-ERG5-PAM-2-F / 4-2-ERG5-PAM-2-R, 4-3-ERG6-PAM-1-F / 4-3-ERG6-PAM-1-R, 4-4-ERG6-PAM-2-F / 1-4-R, refer to "CRISPR-Cas9 System: Application One-step multi-target gene editing technology in Saccharomyces cerevisiae "Construct ERG5, ERG6 g...

Embodiment 2

[0054] Example 2 Knockout of inhibitory genes in 7-dehydrocholesterol synthesis pathway

[0055] On the basis of the strain 7-DHC-1 constructed in Example 1, the endogenous gene MOT3 of Saccharomyces cerevisiae was knocked out, and the single-copy expression cassettes of the endogenous genes ERG2 and ERG3 of Saccharomyces cerevisiae were integrated at this site to relieve the path of ERG2 and so on. The expression of ERG2 and ERG3 was enhanced while the gene expression was restricted. Amplify promoter P using primers PGK1p-F / PGK1p-R PGK1 , primers TDH3p-F / TDH3p-R amplify promoter P TDH3 , the primer TEF1t-F / TEF1t-R amplifies the terminator T TEF1 , using the primers ERG2-F / ERG2-R to amplify the gene ERG2, using the primers ERG3-F / ERG3-R to amplify the gene ERG3, using the primers MOT3-armup-F / MOT3-armup-R and MOT3-armdown-F / MOT3-armdown-R respectively amplified the upstream and downstream homology arms of the MOT3 site. The PCR products were recovered by ethanol precipita...

Embodiment 3

[0056] Example 3: Knockout of NEM1, a gene involved in lipid metabolism

[0057] On the basis of the strain 7-DHC-2 constructed in Example 2, the endogenous gene NEM1 of Saccharomyces cerevisiae was knocked out, and NEM1-armup-F / NEM1-armup-R and NEM1-armdown-F / NEM1-armdown-R were used to expand the Add the upstream and downstream homology arms of the NEM1 site. The PCR product was recovered by ethanol precipitation, and the homology arms were fused by fusion PCR to obtain a gene knockout integration fragment named fragment NEM1-1. The 20nt of NEM1 is cgacgttatggtgaactctg, cgacgttatggtgaactctg. Use primers 7-3-NEM1-PAM-1-F / 7-3-NEM1-PAM-1-R, 7-4-NEM1-PAM-2-F / 1-4-R to obtain gene knockout plasmid 7- 3-3. The knockout plasmid 7-3-3 and the fragment NEM1-1 were efficiently transformed into the strain 7-DHC-2 constructed in Example 2 to obtain the strain 7-DHC-3 in which the gene NEM1 was knocked out. Methods Shake flask fermentation was carried out. The results showed that the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant yeast engineering strain for producing 7-dehydrocholesterol and application of the recombinant yeast engineering strain, and belongs to the technical field of genetic engineering and biological engineering. According to the invention, endogenous genes ERG5 and ERG6 of saccharomyces cerevisiae are knocked out, delta (24)-sterol reductase from Gallus gallus is expressed, synthesis of 7-dehydrocholesterol is promoted by regulating expression of genes of endogenous related pathways, the yield of 7-dehydrocholesterol after fermentation for 72 hours is 440.92 mg / L, and the yield of 7-dehydrocholesterol after fermentation for 96 hours is 520.03 mg / L, so that a foundation is laid for subsequent biosynthesis of steroid compounds; the method has potential value and significance for the development of synthetic biology.

Description

technical field [0001] The invention relates to a recombinant yeast engineering strain for producing 7-dehydrocholesterol and its application, and belongs to the technical field of genetic engineering and bioengineering. Background technique [0002] 7-Dehydrocholesterol is a sterol that is widely present in animals and can be directly converted into vitamin D3 after UV irradiation. Vitamin D3 is widely used in biomedicine, feed aquaculture and other fields. It can be used for the prevention and treatment of rickets and other bone diseases, and can also improve the body's immunity and reduce the risk of cardiovascular diseases. The C25 position of 7-dehydrocholesterol can be converted into 25-hydroxy-7-dehydrocholesterol by related hydroxylase, and 25-hydroxy-7-dehydrocholesterol can generate 25-hydroxyvitamin D3 after certain ultraviolet irradiation, 25- Hydroxyvitamin D3 is the active form of vitamin D3 and is often used in the treatment of people with severe liver and ki...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/19C12N15/81C12N15/90C12N15/53C12N15/61C12N15/55C12N15/31C12P33/02C12R1/865
CPCC12N9/001C12N9/90C12N9/0065C12N9/0006C12N9/0071C12N9/16C07K14/395C12N15/52C12N15/81C12N15/905C12P33/02C12Y103/01072C12Y503/03001C12Y111/01006C12Y101/01C12Y114/19C12Y101/01034C12Y503/03002C12Y301/03016
Inventor周景文魏文倩徐沙余世琴曾伟主
OwnerHUNAN NORCHEM PHARMACEUTICAL CO LTD