Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of genes MsGCHI and MsADCS in increasing folic acid content of plants and promoting plant growth

A technology that promotes plant growth and genes, applied in the biological field, can solve problems such as vitamin B12 deficiency symptoms, environmental pollution, side effects, etc., and achieve the effects of promoting plant growth, increasing plant folic acid content, and promoting growth

Pending Publication Date: 2022-07-05
LANZHOU UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, almost all artificially synthesized folic acid is produced by chemical methods, with many side reactions, and the waste water contains a large amount of ammonia nitrogen and inorganic salts, causing serious pollution to the environment.
In addition, studies in recent years have shown that taking higher doses of artificially synthesized folic acid has certain side effects on the human body, including gene mutations that lead to impaired folic acid metabolism in the human body, masking vitamin B12 deficiency symptoms, and carcinogenesis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of genes MsGCHI and MsADCS in increasing folic acid content of plants and promoting plant growth
  • Application of genes MsGCHI and MsADCS in increasing folic acid content of plants and promoting plant growth
  • Application of genes MsGCHI and MsADCS in increasing folic acid content of plants and promoting plant growth

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1. Synthesis of the full sequence of genes MsGCHI and MsADCS

[0045] 1. Primer Design for Vector Construction

[0046] Table 1 Vector construction primer design

[0047]

[0048]

[0049] Primer 5.0 was used to design specific primers for MsGCHI, MsADCS and Bar genes and Gmubi promoter, and Spe I (P1), Bst EII (P2) and Xho I (P5) were introduced into the 5' and 3' ends of the corresponding sequences, respectively. With Xho I (P6), Hind III (P7) and Kpn I (P8) restriction sites and protection bases (Table 1); in addition, add a FLAG tag sequence (CATTACAAGGATGACGACGATAAG) to the 5' end of the downstream primer of MsGCHI gene, in An HA tag sequence (TACCCATACGATGTTCCAGATTACGCT) was added to the 5' end of the downstream primer of the MsADCS gene.

[0050] Using pMD19-T-GCHI and pMD19-T-ADCS plasmids as templates, and P1, P2, P3, and P4 as specific primers, the amplification of MsGCHI-FLAG fusion gene and MsADCS-HA fusion gene was carried out; using pCAMBIA...

Embodiment 2

[0134] Example 2. Effects of genes MsGCHI and MsADCS on improving plant folic acid content

[0135]The five overexpressed transgenic L. japonicus lines screened in Example 1 were named GA-2, GA-3, GA-5, GA-10 and GA-11, respectively, and were transplanted into flowers containing sterile vermiculite. In pots, water the culture with 1 / 2 Hoagland nutrient solution. And the transgenic lines GA-3, GA-11 and wild-type L. japonicus plants were propagated asexually by the cutting method, watered once every 2 days, and transplanted to a sterile vermiculite plant after the cuttings took root. In the flowerpot, water and cultivate with 1 / 2 Hoagland nutrient solution, the temperature in the plant culture room is 24±2℃, and the light is 16h·d -1 , The relative humidity is about 65%.

[0136] 1. Determination of folic acid and its components

[0137] 1.1 Standard preparation

[0138] Weigh 0.01 g of the standard with an analytical balance and take 100 mL of Na 2 CO 3 The solution (0.1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, in particular to application of genes MsGCHI and MsADCS in increasing the folic acid content of plants and promoting plant growth. Under the greenhouse condition, the folic acid content and the precursor content in the leaves of the transgenic line are obviously higher than those in the wild type, the folic acid content in the leaves of the transgenic line is obviously higher than those in the stems, and the precursor content in the stems is higher than those in the leaves, so that the coexpression of the MsGCHI and the MsADCS can obviously improve the folic acid content and the precursor content in the lotus corniculatus. Meanwhile, the growth speed of the transgenic lotus corniculatus strain GA-3 is obviously superior to that of the wild type, and the branch number and root length of the transgenic lotus corniculatus strain GA-11 are obviously superior to those of the wild type, so that folic acid bioaugmentation has no adverse effect on the growth of the lotus corniculatus, and endogenous folic acid synthesized by folic acid bioaugmentation can promote the growth of the transgenic lotus corniculatus strain.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of genes MsGCHI and MsADCS in increasing the content of folic acid in plants and promoting plant growth. Background technique [0002] Folic acid (Folate) is a water-soluble B vitamin (vitamin B9), which is a micronutrient necessary for the growth and development of animals and plants. Biochemical pathways such as synthesis, the production of reduced coenzyme II (NADPH), and the methionine cycle play a very important role in the metabolism, growth and development of animals and plants. Humans and other animals generally suffer from insufficient folic acid intake. question. Plants and microorganisms can synthesize folic acid in the body, but humans and other mammals cannot synthesize folic acid by themselves due to the lack of a complete biosynthesis system, and must rely on diet to obtain folic acid. Plants are usually the main source of folic acid for animals. The ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/60C12N15/61C12N9/90C12N9/88A01H5/12A01H5/06A01H6/54
CPCC12Y305/04016C12Y401/03038C12N9/90C12N9/88C12N15/8243C12N15/8261Y02A40/10
Inventor 包爱科蔺亚平王锁民
Owner LANZHOU UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More