Unlock instant, AI-driven research and patent intelligence for your innovation.

Genetic engineering strain for producing sterol side chain incomplete degradation product as well as construction method and application of genetic engineering strain

The technology of a genetically engineered strain and a construction method is applied in the field of genetically engineered strains producing incomplete degradation products of sterol side chains and the construction field thereof, which can solve the problems of lack of genetically engineered strains producing PDC-type products, and achieve high economic and social benefits. , The effect of improving product quality and improving production efficiency

Pending Publication Date: 2022-07-08
EAST CHINA UNIV OF SCI & TECH
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a kind of genetically engineered bacterial strain for producing incomplete degradation product of sterol and its construction method and application, thus solve the problem that prior art lacks the genetically engineered bacterium of producing PDC type product

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineering strain for producing sterol side chain incomplete degradation product as well as construction method and application of genetic engineering strain
  • Genetic engineering strain for producing sterol side chain incomplete degradation product as well as construction method and application of genetic engineering strain
  • Genetic engineering strain for producing sterol side chain incomplete degradation product as well as construction method and application of genetic engineering strain

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0064] Preparation of 9OHPDC-M standard product: The fermentation broth of 9OHPDC-M engineering bacteria NwIB-IΔltp2 after batch fermentation of 15g / L phytosterol for 7 days was taken from a 5L bioreactor. The pH of the fermentation broth was first adjusted to around 3 with phosphoric acid. Then the bacterial cells in the fermentation broth were removed by filtration, and the filtrate was extracted three times with an equal volume of ethyl acetate. The organic phases obtained by centrifugation were combined and then washed twice with distilled water and once with saturated brine, and finally with anhydrous MgSO 4 Dry, filter and concentrate under reduced pressure. A mixture of 9-OHPDC-M and its carboxylate 9-OHPDC can be obtained. Separation and purification by silica gel column chromatography using petroleum ether / ethyl acetate as eluent finally recovered 9.86 g of 9-OHPDC-M and 1.27 g of 9-OHPDC.

[0065] 9OHPDC-M standard solution preparation: Weigh 10mg 9OHPDC-M, dissol...

Embodiment 1

[0071] Example 1: Construction of PDC-M engineering strains

[0072] The inventors found through research that in the process of mycobacterial transformation of phytosterols, the last round of β-oxidation in the degradation of the C17 alkyl side chain of a conserved operon igr sterol from the Cho region, which is related to cell growth, is crucial. The operon consists of six genes encoding aldolase (Ltp2), MaoC-like hydratase (ChsH1-H2) consisting of ChsH1 and ChsH2, acyl-CoA dehydrogenase (ChsE1-E2) consisting of ChsE1 and ChsE2, and One Cytochrome P450 Cyp125 (CYP125). We first knocked out ChsH1-H2, ltp2 and the entire igr operon, and the main products were found to be PDC-M. Therefore, the corresponding knockout strains NwIB-XIIΔH12, NwIB-XIIΔltp2, NwIB-XIIΔigr were named as PDC-M series engineering bacteria. Comparing the growth status and product accumulation of the knockout bacteria, we found that the effect of ltp2 knockout on the growth of the strain was relatively ...

Embodiment 2

[0106] Example 2: △ 1 - Construction of PDC-M engineered bacteria

[0107]The first generation PDC-M engineering bacteria NwIB-XII△ltp2 constructed in Example 1 was used as the chassis strain to overexpress 3 keto-△ 1 Dehydrogenase kstD1.

[0108] The gene sequence of M. neoaureus kstD1 (SEQ ID No: 22) has been uploaded to the NCBI database, GeneBank accession number: WP_006246521.1; Region: 121522: 123153, the specific sequence is as follows.

[0109] TCAGGCCTTTCCAGCGAGATGCAATGCGGCGAGGTAGCCGAAGGTCATGGCGGGCCCGATTGTGCCACCCGGGCCGGGATAGGTGTGACCCATCACCGGCGAGCTGACATTGCCTGCCGCATAGAGGCCTTCGATCACCGAATTGTCATCGCGCAGCGCCCGGCCGTGCACGTCGGTGCGGATGCCACCCTTGGTGCCCAGGTCACCGGGCACCATCTTCGCGGCGTAGAACGGGCCGTGTTTGATCTCGCCGAGGTTCGGGTTCGGCTTGTTCGTCGGATCACCGTAGTAGCGGTCGTAGGCGCTCTCGCCGCGGTGGAAGTCCTCGTCGACGCCGGACCGTGCGAAACCGTTGAACCGTTCGATGGTGGCCTTCAGCGCGTCGGCGGCCACACCGGTCTTCTCGGCCAGCTCGGCCAGGCTATCGGCCTTGACGATGATGCCCGATTCCATCCACTTCTTCGGGATGCGTTGTCCGGGTTGCAATCCCGCAAAGATATAGCGATCGCGGTACTGCTGGTCGAAGATCATCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetic engineering strain for producing a sterol side chain incomplete degradation product and a construction method and application thereof, and the construction method comprises the following steps: carrying out inactivation knockout on a gene in an igr operon in a microorganism capable of degrading and converting sterol, and carrying out deletion or / and overexpression on a key gene in a sterol metabolic pathway, therefore, a genetic engineering strain is obtained. The strains can be used for selectively preparing PDC, PDC-M, 1-PDC, 1-PDC-M, 9 alpha-OHPDC and 9 alpha-OHPDC-M, and further can be used for producing steroid drugs such as adrenocortical hormone and the like. According to the method, the production efficiency and the product quality of the steroid medicine can be greatly improved, the energy consumption in the steroid medicine production process is reduced, the production steps are simplified, the utilization rate of the medicine precursor is improved, so that the production cost is reduced, the overall reaction conditions are mild, the method is environment-friendly, and the economic value and the social value are relatively high.

Description

technical field [0001] The invention relates to the field of biochemical industry, and relates to a genetically engineered strain for producing an incomplete degradation product of a sterol side chain and a construction method and application thereof. [0002] technical background [0003] Corticosteroids are an important class of steroids, widely used in the treatment of inflammation, endocrine disorders, cancer and viral infections, especially in the rescue of critically ill patients. For example, low-dose dexamethasone and methylprednisolone have been shown to reduce mortality in patients with severe COVID-19 disease and the World Health Organization has highly valued the preliminary application of dexamethasone in the treatment of severe COVID-19 patients result. The industrial synthesis process of corticosteroids is complicated, due to its complex structure, extremely low yield, and has attracted much attention due to serious environmental pollution problems and high pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/74C12N15/53C12N15/54C12N15/60C12P33/00C12R1/32C12R1/01
CPCC12N9/1037C12N9/88C12N9/001C12N9/0081C12N9/0006C12N9/1029C12N9/0073C12N15/74C12P33/00C12Y103/01008C12Y203/01009C12Y114/13142C12Y103/99004C12N2800/101
Inventor 王风清魏东芝刘勇军宋璐
Owner EAST CHINA UNIV OF SCI & TECH