Genetic engineering strain for producing sterol side chain incomplete degradation product as well as construction method and application of genetic engineering strain
The technology of a genetically engineered strain and a construction method is applied in the field of genetically engineered strains producing incomplete degradation products of sterol side chains and the construction field thereof, which can solve the problems of lack of genetically engineered strains producing PDC-type products, and achieve high economic and social benefits. , The effect of improving product quality and improving production efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0064] Preparation of 9OHPDC-M standard product: The fermentation broth of 9OHPDC-M engineering bacteria NwIB-IΔltp2 after batch fermentation of 15g / L phytosterol for 7 days was taken from a 5L bioreactor. The pH of the fermentation broth was first adjusted to around 3 with phosphoric acid. Then the bacterial cells in the fermentation broth were removed by filtration, and the filtrate was extracted three times with an equal volume of ethyl acetate. The organic phases obtained by centrifugation were combined and then washed twice with distilled water and once with saturated brine, and finally with anhydrous MgSO 4 Dry, filter and concentrate under reduced pressure. A mixture of 9-OHPDC-M and its carboxylate 9-OHPDC can be obtained. Separation and purification by silica gel column chromatography using petroleum ether / ethyl acetate as eluent finally recovered 9.86 g of 9-OHPDC-M and 1.27 g of 9-OHPDC.
[0065] 9OHPDC-M standard solution preparation: Weigh 10mg 9OHPDC-M, dissol...
Embodiment 1
[0071] Example 1: Construction of PDC-M engineering strains
[0072] The inventors found through research that in the process of mycobacterial transformation of phytosterols, the last round of β-oxidation in the degradation of the C17 alkyl side chain of a conserved operon igr sterol from the Cho region, which is related to cell growth, is crucial. The operon consists of six genes encoding aldolase (Ltp2), MaoC-like hydratase (ChsH1-H2) consisting of ChsH1 and ChsH2, acyl-CoA dehydrogenase (ChsE1-E2) consisting of ChsE1 and ChsE2, and One Cytochrome P450 Cyp125 (CYP125). We first knocked out ChsH1-H2, ltp2 and the entire igr operon, and the main products were found to be PDC-M. Therefore, the corresponding knockout strains NwIB-XIIΔH12, NwIB-XIIΔltp2, NwIB-XIIΔigr were named as PDC-M series engineering bacteria. Comparing the growth status and product accumulation of the knockout bacteria, we found that the effect of ltp2 knockout on the growth of the strain was relatively ...
Embodiment 2
[0106] Example 2: △ 1 - Construction of PDC-M engineered bacteria
[0107]The first generation PDC-M engineering bacteria NwIB-XII△ltp2 constructed in Example 1 was used as the chassis strain to overexpress 3 keto-△ 1 Dehydrogenase kstD1.
[0108] The gene sequence of M. neoaureus kstD1 (SEQ ID No: 22) has been uploaded to the NCBI database, GeneBank accession number: WP_006246521.1; Region: 121522: 123153, the specific sequence is as follows.
[0109] TCAGGCCTTTCCAGCGAGATGCAATGCGGCGAGGTAGCCGAAGGTCATGGCGGGCCCGATTGTGCCACCCGGGCCGGGATAGGTGTGACCCATCACCGGCGAGCTGACATTGCCTGCCGCATAGAGGCCTTCGATCACCGAATTGTCATCGCGCAGCGCCCGGCCGTGCACGTCGGTGCGGATGCCACCCTTGGTGCCCAGGTCACCGGGCACCATCTTCGCGGCGTAGAACGGGCCGTGTTTGATCTCGCCGAGGTTCGGGTTCGGCTTGTTCGTCGGATCACCGTAGTAGCGGTCGTAGGCGCTCTCGCCGCGGTGGAAGTCCTCGTCGACGCCGGACCGTGCGAAACCGTTGAACCGTTCGATGGTGGCCTTCAGCGCGTCGGCGGCCACACCGGTCTTCTCGGCCAGCTCGGCCAGGCTATCGGCCTTGACGATGATGCCCGATTCCATCCACTTCTTCGGGATGCGTTGTCCGGGTTGCAATCCCGCAAAGATATAGCGATCGCGGTACTGCTGGTCGAAGATCATCC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



