Method of revealing target protein on cell surface using bactospein S layer protein as carrier and application thereof
A technology of Bacillus aureus and target protein, which is applied in the direction of introducing foreign genetic material, application, chemical instrument and method using a carrier, to achieve the effect of broadening the application field and overcoming the hidden dangers in safety.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] (-) construction of fusion protein gene:
[0045] 1. Select the object to be studied, that is, the target gene,
[0046] 2. Recovery of target gene fragments:
[0047] To recover the target gene fragment from the object to be studied, use the recovery kit of Sangon Company. After agarose gel electrophoresis, EB staining, quickly cut off the target band on a long-wave ultraviolet lamp, put it into an Eppendorf tube and centrifuge to estimate the volume, add 700 μl of solution I and 10 μl of silver beads, sol at 60°C for 10 minutes and make the silverbeads uniform Suspend, centrifuge (10,000r / min for 10sec), discard the supernatant, wash the precipitate with 500μl solution II 3 times, centrifuge (10,000rpm for 10sec), discard the supernatant, and dry the residual liquid on the tube wall with filter paper. Add 5-10 μl of Elution buffer, desorb at 37°C for 2 minutes, centrifuge at 10,000 r / min for half a minute, and the supernatant contains the target fragment. The desor...
Embodiment 2
[0062] Embodiment 2 (the present invention's applicable field example):
[0063] Using the S-layer protein of Bacillus thuringiensis as a carrier is a new surface display system to display the target protein on the cell surface, or optimize the cell surface structure or improve and enhance the biological function of the target protein. Compared with the prior art, the present invention not only overcomes the hidden danger in the safety aspect of the prior art, but also broadens the application field of bacillus thuringiensis (for example, in the aspect of disease resistance, in the adsorption of heavy metals), and has huge research and application prospects .
[0064] 1) Surface display of polyhistidine peptides:
[0065] Primer Design Hisup: GATATCTCTAGAGTCGACCCAAGCGGAACATCACCATTCATCACCAT
[0066] Hisdown: AGCCAATCTAGAGTCAGCTGTCTCGAGCCAGAATGGTGATGATGGTGATG
[0067] The reaction conditions are: 94°C for 30s, 56°C for 30s, 72°C for 30s, a total of 10 cycles; 94°C for 30s, 68...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
