Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method of revealing target protein on cell surface using bactospein S layer protein as carrier and application thereof

A technology of Bacillus aureus and target protein, which is applied in the direction of introducing foreign genetic material, application, chemical instrument and method using a carrier, to achieve the effect of broadening the application field and overcoming the hidden dangers in safety.

Inactive Publication Date: 2006-02-08
HUAZHONG AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the pathogenicity of Bacillus anthracis, its application is limited, so it is particularly necessary to develop a safe and reliable S-layer protein surface display system with a wide range of applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of revealing target protein on cell surface using bactospein S layer protein as carrier and application thereof
  • Method of revealing target protein on cell surface using bactospein S layer protein as carrier and application thereof
  • Method of revealing target protein on cell surface using bactospein S layer protein as carrier and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] (-) construction of fusion protein gene:

[0045] 1. Select the object to be studied, that is, the target gene,

[0046] 2. Recovery of target gene fragments:

[0047] To recover the target gene fragment from the object to be studied, use the recovery kit of Sangon Company. After agarose gel electrophoresis, EB staining, quickly cut off the target band on a long-wave ultraviolet lamp, put it into an Eppendorf tube and centrifuge to estimate the volume, add 700 μl of solution I and 10 μl of silver beads, sol at 60°C for 10 minutes and make the silverbeads uniform Suspend, centrifuge (10,000r / min for 10sec), discard the supernatant, wash the precipitate with 500μl solution II 3 times, centrifuge (10,000rpm for 10sec), discard the supernatant, and dry the residual liquid on the tube wall with filter paper. Add 5-10 μl of Elution buffer, desorb at 37°C for 2 minutes, centrifuge at 10,000 r / min for half a minute, and the supernatant contains the target fragment. The desor...

Embodiment 2

[0062] Embodiment 2 (the present invention's applicable field example):

[0063] Using the S-layer protein of Bacillus thuringiensis as a carrier is a new surface display system to display the target protein on the cell surface, or optimize the cell surface structure or improve and enhance the biological function of the target protein. Compared with the prior art, the present invention not only overcomes the hidden danger in the safety aspect of the prior art, but also broadens the application field of bacillus thuringiensis (for example, in the aspect of disease resistance, in the adsorption of heavy metals), and has huge research and application prospects .

[0064] 1) Surface display of polyhistidine peptides:

[0065] Primer Design Hisup: GATATCTCTAGAGTCGACCCAAGCGGAACATCACCATTCATCACCAT

[0066] Hisdown: AGCCAATCTAGAGTCAGCTGTCTCGAGCCAGAATGGTGATGATGGTGATG

[0067] The reaction conditions are: 94°C for 30s, 56°C for 30s, 72°C for 30s, a total of 10 cycles; 94°C for 30s, 68...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for showing the target protein on the shell surface by using the S-layer protein of Bacillus thuringiensis as carrier includes putting said target protein gene at the downstream of the nucleotide sequence correspondent with the 210-th amino acid at N terminal of S-layer protein, and expressing the fusion protein gene in host bacillus. It can be used for preventing and treating diseases and adsorbing heavy metals.

Description

technical field [0001] The invention belongs to the field of molecular biology, and specifically relates to the use of the S-layer protein derived from Bacillus thuringiensis CTC strain to display the target protein on the cell surface, or to improve the cell surface structure or enhance the biological function of the target protein, and has application potential in many fields . Background technique [0002] Cell surface display refers to the positioning and expression of exogenous macromolecules on the surface of cells through genetic manipulation to achieve certain research and application purposes. In most cases, surface display is achieved by constructing a fusion protein, that is, a foreign protein is fused with a certain surface protein of the bacteria in a certain way, and the former is carried and positioned by means of the surface recognition and localization functions of the latter. on the surface of the cell. Immobilizing foreign prote...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/75C12N15/32C12N15/62C07K14/325C07K19/00A01N63/00
Inventor 孙明喻子牛李林陈守文王莉刘欣吴怀光
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More