Recombinant protein vaccine for preventing and treating human prostata cancer
A recombinant protein, prostate-specific technology, applied in the field of recombinant protein vaccines for the prevention and treatment of human prostate cancer, in the field of genes encoding these two vaccines, which can solve problems such as the inability to effectively activate CTL and the inability to produce tumor preventive and therapeutic effects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0017] Example 1 Obtaining the encoding gene of Mycobacterium tuberculosis 65KD heat shock protein (BCG HSP65)
[0018] BCG Mycobacterium tuberculosis was obtained from Changchun Institute of Biological Products. BCG Mycobacterium tuberculosis was cultured in Sutong potato medium at a temperature of 37-39°C. The bacterial membrane was collected, and the genomic DNA of BCG Mycobacterium tuberculosis was extracted from it.
[0019] The method for extracting the genomic DNA of Mycobacterium tuberculosis refers to Molecular Cloning (J. Sambrook, Isolation of high-molecular-weight DNA from mammalian cells, 9.16-9.22, Cold Spring Harbor Laboratory Press, Molecular cloning, 1989).
[0020] The heat shock protein 65 (HSP65) structural gene was isolated from Mycobacterium tuberculosis by PCR. The 5'-end primer sequence used was 5'CCATG GCC AAG ACA ATT GCG3' (SEQ ID NO: 9), and the 3'-end primer sequence was 5' GAAATCCATGCCACCCAT3' (SEQ ID NO: 10).
[0021] The PCR operation procedur...
Embodiment 2
[0024] Example 2 Construction of BCG heat shock protein 65 human prostate specific antigen cytotoxic T lymphocyte multi-epitope single-copy polypeptide fusion protein gene
[0025] The fusion gene of HSP-65 and the CTL cell epitope of prostate specific antigen (PSA) was synthesized by PCR method. The sequence of the primer at the 5' end is: 5'CCATG GCC AAGACA ATF GCG3' (SEQ ID NO: 11), and the sequence of the primer at the 3' end is: 5'AAGCTTTTTAGTAACTTTCTGCGGGTGAACCTGAGCGCAAACGTCGTTAGAGATAACGTG CAGGTCAACGCACTGCAGTTTTTTCGGAGTCAG GAA GAA ATC CAT GCC ACC CAT GTC 3' (SEQ ID NO. NO: 12). The reaction conditions were: 94°C, 30"; 55°C, 1'; 72°C, 2', after 30 cycles, 72C extension for 10 minutes.
[0026] The PCR product was digested with NcoI and HindIII at 37°C for 2 hours.
[0027] Digestion products were separated by agarose gel electrophoresis. The conditions of electrophoresis are: 1% agarose gel, 1(TAE buffer, 150-200mA, electrophoresis for 0.5-1 hour. 20(TAE buffer: 0.8mol...
Embodiment 3
[0036] Gene sequencing of BCG heat shock protein 65 human prostate specific antigen cytotoxic T lymphocyte multi-epitope single-copy polypeptide fusion protein (using dideoxy end termination method, see the literature for specific methods: Yu Yongli, Ma Tonghui, Yang Guizhen.TA Cloning and double-stranded DNA sequencing: Introduce a method for rapid cloning and analysis of PCR products. Chinese Journal of Immunology, 1994, 10(1): 5) The results show that the obtained BCG heat shock protein 65 human prostate specific antigen cells The gene and design of the multi-epitope single-copy polypeptide fusion protein of toxic T lymphocytes are identical. Example 3 Construction of human prostate specific antigen cytotoxic T lymphocyte poly-epitope double-copy fusion protein vaccine gene containing EcoR1 cut point and Bgl II cut point Human prostate specific antigen cytotoxic T lymphocyte poly-epitope single-copy gene Construct:
[0037] The 5' specific primer [5'GCCGAGAATTCGAGCCTGAAGAG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More