Beta-agaropectinase gene aga, its preparation method and application

An agarase and gene technology, applied in the field of β-agarase gene agaA, can solve the problems that hinder the development and application of agar oligosaccharides, limit the application range, and be expensive, and achieve low cost, easy purification, and stability good sex effect

Inactive Publication Date: 2003-12-10
OCEAN UNIV OF CHINA
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, only β-agarase isolated from Pseudomonas atlantica (Morrice, 1983) has been industrially produced, but it is expensive, has low activity, and its application is limited to scientific research. Greatly hindered the development and application of agar oligosaccharides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Beta-agaropectinase gene aga, its preparation method and application
  • Beta-agaropectinase gene aga, its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] The β-agarase gene agaA of Pseudomonas CY24 was cloned by shotgun method, and the specific operation was as follows: Cultivation of Pseudomonas in Luria-Bertani (LB) medium containing 1% (weight percentage) NaCl (Pseudoalteromonas sp.) CY24 to the end of the logarithmic phase, extract genomic DNA. The genomic DNA was digested with restriction endonuclease HindIII, agarose gel electrophoresis was used to recover a 2.5-7kb fragment, which was ligated with the pBluescript II KS(+) plasmid fragment that was completely digested with HindIII and dephosphorylated. Then transfer the ligated product into competent cells of Escherichia coli DH5α according to the standard calcium chloride method, and cultivate on solid medium (containing ampicillin, X-gal, IPTG) with agar as the sole carbon source, and use whether to produce hydrolysis Circle the positive transformants with agarase activity. Cultivate one of the positive transformants, extract its plasmid DNA by standard alkaline lysi...

Embodiment 2

[0018] Design the upstream primer (5'GGAATTCCATATGAAAGGATTCACTAAG3') and downstream primer: (5'CCGCTCGAGCTGGAATTTAAAACGTTG3') according to the full sequence of the β-agarase gene agaA that has been obtained, using the genomic DNA of Pseudomonas CY24 as a template and PCR amplification Get the full sequence of β-agarase gene. The PCR conditions were as follows: pre-denaturation at 94°C for 3 minutes, followed by 30 cycles of 94°C for 30s, 60°C for 30s, and 72°C for 60s, and finally extension at 72°C for 10 minutes. Agarose gel electrophoresis showed a specific band at 1.36kb, which was cut from the agarose gel, digested with NdeI and XhoI, and a 1.36kb DNA fragment was recovered after agarose gel electrophoresis. The E. coli expression vector pET-24a(+) was similarly digested with NdeI and XhoI, separated by agarose electrophoresis, and a 5.3 kb DNA fragment was recovered. After ligating it with the 1.36 kb DNA fragment obtained above, the standard calcium chloride was used. Method...

Embodiment 3

[0019] The expression vector pEAG was transformed into E. coli BL21 (DE3) according to the standard calcium chloride method, and the transformants with ampicillin resistance were selected. The plasmid was extracted by the standard alkaline lysis method and digested with NdeI and XhoI to obtain two fragments of 1.36 kb and 5.3 kb, which were the same size as the full-length fragment of the β-agarase gene agaA and the expression vector pET-24a(+), which proved Obtained the E. coli recombinant strain pEAG / BL21 that can express β-agarase efficiently. Example 4 Production of recombinant β-agarase using E. coli recombinant strain pEAG / BL21

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invented beta-gelase gene agaA is the gene of beta-gelase of coded pseudoallomonad CY24, the recombinant beta-glase produced by using it has good temp. and pH stability, high activity, can degrade agarose, and its degraded product mainly is new agar oligose whose degree of polymerization is 2-6, so that it can be used for preparing new agar aligose and recovering DNA from agarose gel. The recombinant beta-gelase expressed by said invented colibacillus recombinant strain pEAG / BL 21 is 24% of total protein. Its expression level is high. It is easy to purity. After continuous passage of 20 generations its expression amount is not reduced, therefore said invention can be used for large scale production of recombinant beta-gelase.

Description

Technical field [0001] The invention relates to a β-agarase gene agaA of Pseudoalteromonas sp. CY24. The invention also discloses the production method and application of the vector containing the gene and the recombinant strain of Escherichia coli and the expression product thereof. Background technique [0002] The agar main chain is made up of 1,3-linked β-D-galactopyranos and 1,4-linked 3,6-lactone-α-L-galactopyranos repeatedly and alternately connected. In recent years, with the rapid development of glycobiology and chemistry research, people have discovered that agar oligosaccharides with different degrees of polymerization have important medicinal values, such as anti-tumor, anti-aging, and diabetes prevention. They are expected to develop into a new generation of oceans. drug. The preparation of agar oligosaccharides mainly includes enzymatic method and acid hydrolysis method, and enzymatic hydrolysis method is better than acid hydrolysis method, which is conducive to the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N9/00C12N15/52C12N15/70C12P19/00
Inventor褚艳韩峰李京宝路新枝
OwnerOCEAN UNIV OF CHINA