Identification of oligonucleotides for the capture, detection and quantitation of hepatitis A viral nucleic acid

A technology of hepatitis A virus, oligonucleotide, applied in the field of virus diagnosis

Inactive Publication Date: 2005-09-28
CHIRON CORP
View PDF15 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, transfusion of plasma products may also be a route of HAV transmission

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification of oligonucleotides for the capture, detection and quantitation of hepatitis A viral nucleic acid
  • Identification of oligonucleotides for the capture, detection and quantitation of hepatitis A viral nucleic acid
  • Identification of oligonucleotides for the capture, detection and quantitation of hepatitis A viral nucleic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0162] Extraction of HAV RNA from Biological Samples

[0163] HAV nucleic acid positive sera were purchased from BioClinical Partners (Berkeley, CA). Nucleic acids are isolated from samples by two methods. Specifically, RNA is extracted by (a) binding to silica; (b) annealing with target-specific oligonucleotides.

[0164] (a) Isolation of nucleic acids by binding to silica

[0165] RNA was extracted by binding to silica using the method described by Boom, R. et al., (1990) "A fast and simple method for the purification of nucleic acids", J. Clin. Microbiol. 28, 495-503. Nucleic acids can bind to silica in the presence of high concentrations of chaotropic salts such as guanidine isothiocyanate. Small nucleic acids bind silica more efficiently at acidic pH. Bound nucleic acids are easily eluted under conditions of low salt, alkaline pH buffer, and high temperature. The use of magnetized silica instead of ordinary silica can greatly facilitate washing and...

Embodiment 2

[0184] by TaqMan TM Detection of HAV RNA

[0185] Use TaqMan TM technology to amplify captured target RNA. Several HAV-specific oligonucleotide amplification primers were designed for this purpose. Primers are as follows:

[0186] Primers and probes for amplification of the 5' untranslated region:

[0187] VHAV1-GGATTGATTGTCAGGGCTGTC (forward primer-nt538-558) (Seq ID No.: 1)

[0188] VHAV2-CCCTCTCACAGGATCCCATTT (reverse primer-nt612-632, reverse complementary) (Seq ID No.: 2)

[0189] VHAV3-XCCTCTCTGTGCTTAGGGCAAACACCATTTZ (probe-nt576-605) (Seq ID No.: 3)

[0190] Where X = 6-FAM (fluorescein), Z = linker + TAMRA (tetramethylrhodamine).

[0191] The nucleic acid of Example 1 was diluted to about 100 IU / 20 µl. Reagents used for TaqMan assays were from Applied Biosystems, Foster City, CA. TaqMan TM The final volume of the reaction mixture is 50ml, containing: 25ml TaqMan TM One-step RT-PCR mixture, each amplification primer 0.5pmol, 0.2pmol probe. The rea...

Embodiment 3

[0194] Detection of amplification efficiency and capture oligonucleotide combinations

[0195] The 5'UTR nucleotide sequence of HAV was synthesized according to the sequence of NCBI K02990. This sequence was cloned into the M13 plasmid to obtain single-stranded DNA, and the resulting single-stranded DNA was purified.

[0196] (a) Amplification efficiency

[0197] Concentrations of cloned and purified DNA were determined spectrophotometrically, and DNA dilutions ranging from 10,000 to 0.5 Cps were used for each TaqMan amplification using methods, primers and probes as previously described. In general, samples with a signal threshold greater than 0.2 within 45 cycles are considered positive. Table 1 shows the detailed test results.

[0198] cps / rxn

cycle45

0.5cp

0.157663

1cp

0.299065

5cp

0.8231

10cp

1.115975

50cp

1.34539

100cp

1.13805

500cp

2.361416

1000c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Hepatitis A virus-specific primers and probes derived from conserved regions of the hepatitis A virus genome are disclosed. Also disclosed are nucleic acid-based assays using the capture oligonucleotides, primers and probes.

Description

technical field [0001] The present invention relates to the field of virus diagnosis. More specifically, the present invention relates to nucleic acid analysis methods for accurate diagnosis of hepatitis A virus infection and detection of hepatitis A virus in biological samples. Background of the invention [0002] Hepatitis A is an intestinal infection that can cause fever, malaise, loss of appetite, nausea, abdominal discomfort, and jaundice. Hepatitis A is caused by infection with hepatitis A virus, a small non-enveloped spherical virus belonging to the family Picornaviridae and the genus Hepacivirus. The HAV genome consists of a single-stranded linear RNA molecule with a length of 7.5kb. The polyprotein precursor encoded by it is processed to form a structural protein and has the enzyme activity required for virus replication (Najarian et al., Proc.Natl.Acad.Sci . USA 82: 2627-2632 (1985)). HAV grows poorly in cell culture, produces a small number of viruses, and cann...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G01N21/78C07H21/04C12NC12N15/09C12N15/51C12Q1/25C12Q1/68C12Q1/70
CPCC12Q1/706C12Q1/703Y02A50/30C12Q2563/107C12Q2545/114C12Q2525/15C12Q2563/143C12Q1/6883C12Q1/6888C12Q1/6834
InventorV·石亚马拉
OwnerCHIRON CORP