Method for predicting angiotonin II receptor agonist hypotensor function and use
An angiotensin and antagonist technology, which is applied in the field of predicting the action of angiotensin II receptor antagonist antihypertensive drugs, and can solve the problems of unseen atrial natriuretic peptide association research and unseen kit products, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Example 1: Determination of the Val7Met polymorphism of the ANP gene and prediction of the antihypertensive effect of angiotensin II receptor 1 antagonist antihypertensive drug irbesartan
[0061] (1) Determination of the Val7Met polymorphic site genotype of the ANP gene:
[0062] (1) Extract the genomic DNA of the host cell:
[0063] (a) Add 30ml of erythrocyte lysate to the whole blood, shake slowly, and let stand at room temperature for 10 minutes. During this period, shake several times to completely lyse the erythrocytes;
[0064](b) Centrifuge at 4°C at 2000 rpm for 10 minutes, remove the supernatant, break up the precipitated leukocytes on a rotary shaker, add 40ul of protease and 50ul of RNase, shake well, add 15ml of leukocyte lysate, Mix well in a 37°C water bath for 20 minutes, take it out, and put it in cold water;
[0065] (c) Add 4ml of cold protein precipitation solution, mix well and place in -20°C refrigerator for 5 minutes, take it out and centrifuge...
Embodiment 2
[0096] Example 2: Determination of the Val7Met polymorphism of the ANP gene to predict the target organ impact of angiotensin II receptor 1 antagonist antihypertensive drug irbesartan
[0097] (1) Measure the Val7Met polymorphic site genotype of the ANP gene (same as Example 1)
[0098] (2) Predict the risk of microalbuminuria:
[0099] For patients with essential hypertension, the risk of microalbuminuria in genotype 7Val / Met heterozygous or 7Met / Met homozygous mutant individuals is significantly higher than that of genotype 7Val / Val homozygous wild-type individuals.
[0100] The above method was verified by research, and patients with essential hypertension were grouped; ANP genotypes were grouped (homozygous wild type group, heterozygous type group + homozygous mutant group), and proteinuria was observed. The results are as follows:
[0101] In patients with essential hypertension, the risk of microalbuminuria in individuals carrying the 7Met allele was significantly highe...
Embodiment 3
[0104] Embodiment 3: kit composition (PCR-RFLP method) and application
[0105] 1. Kit components include:
[0106] Solution A: PCR buffer (PCR buffer), the components are KCL, Tris-HCl and MgCl2;
[0107] Solution B: deoxymononucleotide triphosphate (dNTP);
[0108] Liquid C: primer (Primer), synthesized by an oligonucleotide synthesizer; the sequence of the primer in the kit is:
[0109] Upstream primer: 5'GCCTGTAAGTCCTAGCTACTCC3'
[0110] Downstream primer: 5'GAATATTTTTAATTTCCCAGTGC3'
[0111] Solution D: heat-resistant DNA polymerase (Taq); storage temperature is -20°C;
[0112] Solution E: restriction endonuclease HpaII; storage temperature is -20°C;
[0113] Solution F: restriction endonuclease buffer, the components are Tris-HCl, NaCl, MgCl2, dithiothreitol.
[0114] 2. The steps of using this kit to amplify functional polymorphic sites and their flanking sequences and detect the genotypes of polymorphic sites are as follows:
[0115] (1) Amplify the target gene ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com