Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant fusion protein of fibroin and RGD, and its biological synthesis method

A technology of fusion protein and synthesis method, applied in the biological field, can solve the problems of difficult control of protein molecular weight, permeability, and degradation rate that cannot meet tissue engineering, poor adhesion, etc., and achieve the effect of solving poor cell adhesion activity

Inactive Publication Date: 2008-01-16
ZHEJIANG SCI-TECH UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The average molecular weight of animal silk protein is relatively large, generally 300-400kDa, high molecular weight usually has high strength, but its permeability and degradation speed are difficult to meet the requirements of various tissue engineering, especially cell culture scaffolds
However, through chemical or enzymatic degradation, the molecular weight of the protein is difficult to control
[0004] (2) The adhesion between animal silk protein material and cells is poor
At present, it is solved by modifying the surface of animal silk protein materials by selecting materials that are conducive to cell adhesion, but its product quality is difficult to control, so it cannot be widely used.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant fusion protein of fibroin and RGD, and its biological synthesis method
  • Recombinant fusion protein of fibroin and RGD, and its biological synthesis method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Embodiment 1, the construction of recombinant animal silk-RGD fusion protein particles:

[0051]The amino acid sequence of a designed recombinant animal silk-RGD fusion protein is as follows: [Thr-Gly-Arg-Gly-Asp-Ser-Pro-Ala-Gly-Val-Pro-Gly-Val-Gly-Val-Pro-Gly -Val-Gly-Gly-Gly-Ala-Gly-Ala-Gly-Ser-Gly-Ala-Gly-Ala-Gly-Ser-Gly-Ala-Gly-Ala-Gly-Ser-Ala-Ser]n

[0052] (1) Designed and synthesized four oligonucleotides: RGD-1, RGD-2, Silk-1 and Silk-2, and then used the annealing method to obtain two double-helical DNAs respectively, and their nucleotide sequences were respectively for:

[0053] RGD-1:

[0054] 5' AATTCACTAGTACCGGCCGTGGTGATTCTCCGGCTGGCGTACCAGGTGTTGGCGTTCCGGGTGTG 3'

[0055] RGD-2:

[0056] 5’ ACCCCCCACACCCGGAACGCCAACACCTGGTACGCCAGCCGGAGAGTCACCACGGCCGGTACTAGTG 3’

[0057] Silk-1:

[0058] 5' GGGGGTGGTGCAGGTGCTGGCTCCGGTGCCGGCGCGGGGAGCGGGGCAGGCGCAGGTTCTGCTAGCG 3'

[0059] Silk-2:

[0060] 5'

[0061] GATCCGCTAGCAGAACCTGCGCCTGCCCCGCTCCCCGCGCCGGCACCGGAGCCA...

Embodiment 2

[0077] Embodiment 2, expression of recombinant animal silk-RGD fusion protein:

[0078] (1) Transform the pET30a(+)-SilkRGD(n) verified by sequencing, such as pET30a(+)-SilkRGD(10) plasmid into competent cell BL21(DE3)pLysS (purchased from Novagen) bacteria, pick a single colony and inoculate in LB liquid medium, cultured with shaking at 37°C overnight, then inoculated in TB liquid medium containing 10-50 μg / ml kanamycin and 25-170 μg / ml chloramphenicol at a ratio of 1:100, when OD 600 When reaching about 0.5-1.0, add inducer IPTG to induce protein expression, and the concentration of IPTG is 0.1-2mM. After continuing to cultivate for 2-5 hours, the bacterial cells were collected by centrifugation (5000×g, 4° C. for 10 minutes).

[0079] The special feature of the present invention is that the time and temperature for inducing expression can be adjusted according to the actual situation, such as the solubility, stability and expression level of the target protein, which can b...

Embodiment 3

[0080] Embodiment 3, the purification of recombinant animal silk-RGD fusion protein:

[0081] The bacteria collected above were resuspended with ice-cold cell lysis buffer (Cell Lysis Buffer) 3-7 times the wet weight of the cells, placed in an ice bath, and the cells were ultrasonically disrupted to release the protein SilkRGD (10). After the cells are broken, the viscosity of the liquid increases. If the viscosity of the mixed solution is too high, the cell lysate can be diluted appropriately, or the solution containing MgCl can be added. 2 (5 mM final concentration) of 10 μg / ml protease-free DNase to reduce viscosity. Centrifuge at 20,000×g at 4°C for 30 minutes, and the supernatant is the clarified crude cell extract. The crude extract was subjected to metal chelation chromatography, dialyzed in distilled water, and then freeze-dried to collect the protein.

[0082] Protein expression and purification results were confirmed by SDS-PAGE gel electrophoresis (Figure 2). In ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a restructuring animal yarn-RGD merged protein and its biosynthesis method, the amino acid sequence of restructuring animal yarn-RGD merged protein contains sequence which roots from nature animal yarn protein and sequence contains short peptide RGD, it also contains the biosynthesis method of this merged protein. The restructuring animal yarn-RGD merged protein of this invention has structure and function of nature animal yarn protein as well as cell adhesive activity, it also provides a method which uses gene recombination and fermentation technique to synthesize simulated nature animal yarn protein, the merged protein can be used to surface finish of medical material, it can be used as degradable medical biological material after processing and applied in organization project.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a recombinant animal silk-RGD fusion protein with cell adhesion activity synthesized by gene recombination and fermentation technology and a synthesis method thereof. Background technique [0002] Natural animal silk (including silk and spider silk, etc.) protein fibers have good mechanical properties. In addition to being used as traditional textile raw materials, they are being continuously developed and utilized in the fields of cosmetics, food, pharmaceuticals, and new materials. Most animal silk proteins include fibroin and sericin. Since sericin has poor biocompatibility and is prone to allergic reactions, the animal silk protein referred to in the present invention is silk fibroin. Due to its superior mechanical properties, relatively good biocompatibility, easy degradability, easy to degrade and the degradation products are easily absorbed by the human body without inflammat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/09
Inventor 姚菊明
Owner ZHEJIANG SCI-TECH UNIV