Recombinant fusion protein of fibroin and RGD, and its biological synthesis method
A technology of fusion protein and synthesis method, applied in the biological field, can solve the problems of difficult control of protein molecular weight, permeability, and degradation rate that cannot meet tissue engineering, poor adhesion, etc., and achieve the effect of solving poor cell adhesion activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Embodiment 1, the construction of recombinant animal silk-RGD fusion protein particles:
[0051]The amino acid sequence of a designed recombinant animal silk-RGD fusion protein is as follows: [Thr-Gly-Arg-Gly-Asp-Ser-Pro-Ala-Gly-Val-Pro-Gly-Val-Gly-Val-Pro-Gly -Val-Gly-Gly-Gly-Ala-Gly-Ala-Gly-Ser-Gly-Ala-Gly-Ala-Gly-Ser-Gly-Ala-Gly-Ala-Gly-Ser-Ala-Ser]n
[0052] (1) Designed and synthesized four oligonucleotides: RGD-1, RGD-2, Silk-1 and Silk-2, and then used the annealing method to obtain two double-helical DNAs respectively, and their nucleotide sequences were respectively for:
[0053] RGD-1:
[0054] 5' AATTCACTAGTACCGGCCGTGGTGATTCTCCGGCTGGCGTACCAGGTGTTGGCGTTCCGGGTGTG 3'
[0055] RGD-2:
[0056] 5’ ACCCCCCACACCCGGAACGCCAACACCTGGTACGCCAGCCGGAGAGTCACCACGGCCGGTACTAGTG 3’
[0057] Silk-1:
[0058] 5' GGGGGTGGTGCAGGTGCTGGCTCCGGTGCCGGCGCGGGGAGCGGGGCAGGCGCAGGTTCTGCTAGCG 3'
[0059] Silk-2:
[0060] 5'
[0061] GATCCGCTAGCAGAACCTGCGCCTGCCCCGCTCCCCGCGCCGGCACCGGAGCCA...
Embodiment 2
[0077] Embodiment 2, expression of recombinant animal silk-RGD fusion protein:
[0078] (1) Transform the pET30a(+)-SilkRGD(n) verified by sequencing, such as pET30a(+)-SilkRGD(10) plasmid into competent cell BL21(DE3)pLysS (purchased from Novagen) bacteria, pick a single colony and inoculate in LB liquid medium, cultured with shaking at 37°C overnight, then inoculated in TB liquid medium containing 10-50 μg / ml kanamycin and 25-170 μg / ml chloramphenicol at a ratio of 1:100, when OD 600 When reaching about 0.5-1.0, add inducer IPTG to induce protein expression, and the concentration of IPTG is 0.1-2mM. After continuing to cultivate for 2-5 hours, the bacterial cells were collected by centrifugation (5000×g, 4° C. for 10 minutes).
[0079] The special feature of the present invention is that the time and temperature for inducing expression can be adjusted according to the actual situation, such as the solubility, stability and expression level of the target protein, which can b...
Embodiment 3
[0080] Embodiment 3, the purification of recombinant animal silk-RGD fusion protein:
[0081] The bacteria collected above were resuspended with ice-cold cell lysis buffer (Cell Lysis Buffer) 3-7 times the wet weight of the cells, placed in an ice bath, and the cells were ultrasonically disrupted to release the protein SilkRGD (10). After the cells are broken, the viscosity of the liquid increases. If the viscosity of the mixed solution is too high, the cell lysate can be diluted appropriately, or the solution containing MgCl can be added. 2 (5 mM final concentration) of 10 μg / ml protease-free DNase to reduce viscosity. Centrifuge at 20,000×g at 4°C for 30 minutes, and the supernatant is the clarified crude cell extract. The crude extract was subjected to metal chelation chromatography, dialyzed in distilled water, and then freeze-dried to collect the protein.
[0082] Protein expression and purification results were confirmed by SDS-PAGE gel electrophoresis (Figure 2). In ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 