Double genes knockout Listeria monocytogenes attenuation mutant and constructing method

A technology of Listeria, monocytes, applied to other methods of inserting foreign genetic material, bacteria, genetic engineering, etc.

Inactive Publication Date: 2008-03-12
YANGZHOU UNIV
View PDF0 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] The use of vaccines to prevent infectious diseases in modern medicine is the most effective measure, but there are still challenges in the prevention and control of infectious diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double genes knockout Listeria monocytogenes attenuation mutant and constructing method
  • Double genes knockout Listeria monocytogenes attenuation mutant and constructing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] The method for constructing an attenuated Listeria monocytogenes attenuated mutant strain with actA and pclB double gene deletion is characterized in that after amplifying the homologous fragments actA and plcB on both wings of the gene to be deleted, they are spliced ​​together by SOEing PCR method, Insert into the shuttle vector pKSV7, and introduce into Listeria monocytogenes by electrotransformation, the steps are:

[0020] 1. Amplification of Homologous Fragment of ActA Gene of Listeria monocytogenes

[0021] Listeria monocytogenes LM4 was suspended in 100 μL ultrapure water at a concentration of 10 9 CFU / ml, heat at 100°C for 10 minutes, centrifuge at 12,000 rpm for 5 minutes, take 5 μL of the supernatant for PCR amplification reaction, and use the following primers:

[0022] Justice: 5'CC GAATTC TTTAGTTCCGCAGTGGATGC3'

[0023] Antisense: 5'GTCTAGCTCCAGTAGGGGATCCCTCGAGGCTGCAAATATTATG3'

[0024] The sense primer contains an ECoRI restriction site (underlined). ...

Embodiment 2

[0080] Embodiment 2: Western-blot analysis

[0081] After SDS-PAGE electrophoresis, the purified actA protein was transferred to a nitrocellulose membrane, and the polyantisera of yzu LM1-2 and LM4 were used as primary antibodies, and horseradish peroxidase-labeled goat anti-mouse IgG antibodies As the secondary antibody, diaminobenzidine (DAB) was used as the substrate for western blot analysis.

[0082] As shown in the western blot results shown in Figure 1, in lane 1, there is a specific imprint band with a size of about 97kD, but there is no imprint band in lane 2, indicating that the serum prepared from mice immunized with yzu LM1-2 does not target actA The antibody also confirmed the deletion of actA gene at the protein level.

Embodiment 3

[0083] Embodiment 3: Phospholipase activity test

[0084] Identification of biological activity: PC-PLC has the biological activity of hydrolyzing phospholipids to produce a series of water-soluble fatty acids, and egg yolk is rich in phospholipids, so the egg yolk agar method has become a convenient method for qualitatively identifying the biological activity of PC-PLC. Prepare egg yolk agar charcoal powder (YAC) medium: add 0.5 g of activated carbon powder to 100 ml of BHI solid medium, adjust the pH value to 6.5, and then autoclave it. After cooling to 45 ° C, yzu LM1-2 is scratched on the surface of the YAC medium. Line inoculated and cultured at 37°C.

[0085] After about 24 hours of cultivation on YAC medium, a transparent circle appeared around the wild-type LM4 strain inoculated on the plate. However, this phenomenon does not appear around the yzu LM1-2, as shown in Figure 2. This shows that yzuLM1-2 does not have phospholipase biological activity, thus indicating th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction way for toxic gene deletion of a wild Listeria monocytogenes (short as LM). After expanding homogenetic sectionsactA and plcB at two wings of the genes to be deleted, the actA and plcB are spliced by SOEing PCR method, inserted into a penetrating carrier pKSV7, introduced by electric transferring into Listeria monocytogenes, so as to get Listeria monocytogenes yzu LM1-2 with actA and pclB deleted, the preservation no. for the Listeria monocytogenes yzu LM1-2 is CCTCC NO: M206107. The invention solves the pathogen for human being and animals of Listeria monocytogenes, high death rate and pollution and harm of LM on food. The invention deletes actA and plcB, hence reduces the toxicity of the wild bacterial strain yzu LM4.

Description

technical field [0001] The present invention relates to a construction method for deleting the virulence gene of wild-type Listeria monocytogenes, in particular to a primer design for gene deletion, an electrotransformation method, and simultaneous realization of chloramphenicol resistance through temperature and chloramphenicol resistance pressure. The method of source recombination and removal of the plasmid was used to obtain the attenuated mutant strain of Listeria monocytogenes (Listeriamonocytogenes yzu LM1-2), the preservation number CCTCC NO: M206107. Background technique [0002] The use of vaccines to prevent infectious diseases in modern medicine is the most effective measure, but there are still challenges in the prevention and control of infectious diseases. Most traditional vaccines only rely on humoral immunity to protect against pathogenic bacteria, while the elimination of intracellular bacteria also needs to be mediated by cellular immunity. [0003] Befor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/87C12N15/31C12N15/74
Inventor焦新安殷月兰潘志明孙林黄金林袁舟
OwnerYANGZHOU UNIV