Gene chip and reagent box for detecting food-borne virus

A gene chip and food-borne technology, applied in the field of gene chips and kits for detecting food-borne viruses, can solve the problems of being unsuitable for virus detection, low virus content, unsuitable for hepatitis A virus detection, etc.

Inactive Publication Date: 2011-06-08
PEOPLES REPUBLIC OF CHINA BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] It is very difficult to culture and isolate food-borne viruses in vitro. For example, among the most common and important Norwalk virus and hepatitis A virus in food poisoning, only hepatitis A virus can reproduce in host cells and use host cells for replication. The virus grows slowly in cells, and it takes 3-4 generations of culture to show visible lesions, and the virus content in food is often very low. Therefore, it often takes 30-60 days to isolate hepatitis A virus by the culture method, which is not suitable for use in Detection of hepatitis A virus in food
Norwalk virus can not reproduce in vitro, and there is no animal model, and it cannot be isolated and detected by tissue culture or animal experiments. At the same time, its infectious dose is very low, estimated to be 10 0 -10 2 Infectious units, the detection limit of conventional electron microscopy is 10 5 -10 6 Virus particles / ml, the sensitivity cannot meet the requirements to ensure food safety
Recently, radioimmunoassay (EIA) based on ELISA technology has been used for the clinical diagnosis of Norovirus, but it is not suitable for the detection of viruses in food due to the limitation of the detection limit.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene chip and reagent box for detecting food-borne virus
  • Gene chip and reagent box for detecting food-borne virus
  • Gene chip and reagent box for detecting food-borne virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1: Preparation of gene chip

[0066] 1. Materials and methods

[0067] 1. Materials

[0068] Entrusted Yingjun Biotechnology Co., Ltd. to synthesize probes. In order to make the probe molecules stretch out on the chip and facilitate the hybridization of target probes, an amino group and 15 amino groups were added to the 5' of each probe during synthesis. T.

[0069] Substrate: Aldehyde glass substrate, Beijing Boao Biochip Co., Ltd.

[0070] crystal SmartArrayer TM 48 Microarray Chip Spotting System, Boao Biological Co., Ltd.

[0071] 2. Method

[0072] 1. Probe Design and Synthesis

[0073] Collect the virus genes to be tested published by GenBank, find out the conserved segments through homology comparison, and then calculate the conserved segments of these viruses with strict and uniform conditions (Tm value, GC content, secondary structure, etc.) The probes are modified with amino groups at the 5' end, see Table 1. The detection probe has the nucle...

Embodiment 2

[0079] Embodiment 2: detection method

[0080] 1. Materials

[0081] 1. The positive samples of hepatitis A virus and poliovirus were from commercially available vaccines.

[0082] 2. Norovirus type II, astrovirus and rotavirus samples were obtained from Beijing Children's Hospital, and were isolated from 16 stool samples of infants.

[0083] 2. Method

[0084] 1. Extract the total RNA of the sample to be tested by a conventional method (TRIzol method).

[0085] 2. RT-PCR of RNA

[0086] (1) See Table 2 for primer sequences.

[0087] Table 2: Primer sequences

[0088]

[0089]

[0090] (2) Reverse transcription, reaction system and conditions:

[0091] Table 3: Reverse transcription reaction system

[0092]

[0093] 3. PCR amplification:

[0094]Design specific primers according to the viral sequence, and use the cDNA generated by reverse transcription as a template for PCR amplification. The system is shown in Table 4 and the conditions are shown in Table 5. ...

Embodiment 3

[0114] Example 3: Chip detection specificity verification

[0115] 1. Hepatitis A virus positive samples

[0116] 1. Extracting total viral RNA, see Example 2 for specific methods.

[0117] 2. Reverse transcription, reaction system and conditions are the same as Table 3:

[0118] HAV-R (5mM) sequence is CCCAATCGAATCTGAAGCAT SEQ ID No.14

[0119] 3. PCR amplification: Perform PCR amplification using cDNA as a template, the system is the same as in Table 4, and the conditions are as in Table 5:

[0120] HAV-F (unmarked 5uM) sequence is TGTGCTATGGTTCCTGGTGA SEQ ID No.15

[0121] HAV-R (fluorescent label 40uM) sequence is CCCAATCGAATCTGAAGCAT SEQ ID No.14

[0122] 4. Agarose gel electrophoresis, if there are obvious bands detected, it proves that there is amplification;

[0123] 5. Hybridization reaction, see Example 2.

[0124] 6. Chip cleaning, see Example 2.

[0125] 7. Chip scanning results: see Figure 3-1 and 3—2 , The actual experimental results of Hepatitis A vacc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a gene chip for detecting food-home virus and a kit, belonging to the inspection field. The surface of a solid phase carrier is fixed with a plurality of detection probes and quality control contrast probes, wherein, the detection probes consist of the probes for detecting hepatitis A virus, human astrovirus, norwalk virus G1, norwalk virus G2, rotavirus, polio virus 1, polio virus 2 and polio virus 3; and the quality control contrast probes consist of a spotting positive quality control probe, a chip hybridization positive quality control probe and a chip negative quality control probe. The gene chip and the kit have the advantages of: (1) high throughout: five common viruses are integrated and detected simultaneously, and the practicability is strong; (2) rapidness: the detection time is only 4 hours; (3) specificity: the false positive caused by the cross reaction is avoided; (4) flexibility: the detection flexibility of the chip is 10<8> virus particles per gram of the tissue sample, which is higher than that of RT-PCR; and (5) good repetitiveness and stable results. The gene chip and the kit can be widely applied to the food safety inspection of the inspections system.

Description

technical field [0001] The invention relates to a gene chip and a kit for detecting food-borne viruses, belonging to the technical field of inspection and quarantine. Background technique [0002] Food safety has always been a hot issue of concern to the international community and governments of various countries. It is estimated that 76,000,000 people suffer from food poisoning and 5,000 people die every year in the United States. At present, more than 200 kinds of diseases are known to be transmitted through food, and more than half of the food poisoning cases have not found the cause, indicating that there are more than 200 causes of food poisoning. Among food microbial poisoning factors, due to the limitation of detection methods, usually only bacterial indicators are detected, and virus contamination in food cannot be effectively monitored and analyzed. According to the US FDA estimates, food poisoning caused by viruses leads to Nearly 10,000,000 cases, 128 deaths; No...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/70C12Q1/68
CPCY02A50/30
Inventor陈广全曾静张惠媛绕红汪琦张亮张捷魏海燕张昕臧庆伟付溥博
OwnerPEOPLES REPUBLIC OF CHINA BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU